dna_sequence stringlengths 165 2.06M | labels listlengths 165 2.06M | metadata stringlengths 47 64 |
|---|---|---|
"TTACACATTCTTGTAAGTGGTTTATTGAGAGCTGATTTGTCAATCAAAGAACACACCATAATGATGGGAATATTGATGATTTCAACATAAAAAAATTTA(...TRUNCATED) | [[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0](...TRUNCATED) | mRNA|gene-DZANK1|rna-XM_054323589.1|-|18434464:18518130 |
"TTACACATTCTTGTAAGTGGTTTATTGAGAGCTGATTTGTCAATCAAAGAACACACCATAATGATGGGAATATTGATGATTTCAACATAAAAAAATTTA(...TRUNCATED) | [[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0](...TRUNCATED) | mRNA|gene-DZANK1|rna-XM_054323591.1|-|18434464:18518130 |
"TTACACATTCTTGTAAGTGGTTTATTGAGAGCTGATTTGTCAATCAAAGAACACACCATAATGATGGGAATATTGATGATTTCAACATAAAAAAATTTA(...TRUNCATED) | [[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0](...TRUNCATED) | mRNA|gene-DZANK1|rna-NM_001367619.1|-|18434464:18518130 |
"TTACACATTCTTGTAAGTGGTTTATTGAGAGCTGATTTGTCAATCAAAGAACACACCATAATGATGGGAATATTGATGATTTCAACATAAAAAAATTTA(...TRUNCATED) | [[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0](...TRUNCATED) | mRNA|gene-DZANK1|rna-NM_001367618.1|-|18434464:18518130 |
"TTACACATTCTTGTAAGTGGTTTATTGAGAGCTGATTTGTCAATCAAAGAACACACCATAATGATGGGAATATTGATGATTTCAACATAAAAAAATTTA(...TRUNCATED) | [[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0](...TRUNCATED) | mRNA|gene-DZANK1|rna-XM_054323596.1|-|18434464:18518130 |
"TTACACATTCTTGTAAGTGGTTTATTGAGAGCTGATTTGTCAATCAAAGAACACACCATAATGATGGGAATATTGATGATTTCAACATAAAAAAATTTA(...TRUNCATED) | [[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0](...TRUNCATED) | mRNA|gene-DZANK1|rna-XM_054323595.1|-|18434464:18518130 |
"TTACACATTCTTGTAAGTGGTTTATTGAGAGCTGATTTGTCAATCAAAGAACACACCATAATGATGGGAATATTGATGATTTCAACATAAAAAAATTTA(...TRUNCATED) | [[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0](...TRUNCATED) | mRNA|gene-DZANK1|rna-XM_054323593.1|-|18434464:18518130 |
"TTACACATTCTTGTAAGTGGTTTATTGAGAGCTGATTTGTCAATCAAAGAACACACCATAATGATGGGAATATTGATGATTTCAACATAAAAAAATTTA(...TRUNCATED) | [[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0](...TRUNCATED) | mRNA|gene-DZANK1|rna-NM_001351683.4|-|18434464:18518130 |
"TTACACATTCTTGTAAGTGGTTTATTGAGAGCTGATTTGTCAATCAAAGAACACACCATAATGATGGGAATATTGATGATTTCAACATAAAAAAATTTA(...TRUNCATED) | [[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0](...TRUNCATED) | mRNA|gene-DZANK1|rna-XM_054323587.1|-|18434464:18518130 |
"TTACACATTCTTGTAAGTGGTTTATTGAGAGCTGATTTGTCAATCAAAGAACACACCATAATGATGGGAATATTGATGATTTCAACATAAAAAAATTTA(...TRUNCATED) | [[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0],[1.0,0.0](...TRUNCATED) | mRNA|gene-DZANK1|rna-XM_054323601.1|-|18434464:18518083 |
Ab inition gene segmentation benchmark (GENATATORs)
Overview
genatator-segmentation-dataset is a nucleotide-level gene segmentation dataset designed for training and evaluating DNA language models and related sequence models on transcript structure prediction. The dataset targets biologically detailed reconstruction of transcript architecture. In particular, it utilizes nucleotide-resolution labels describing the internal organization of transcripts, including 5' untranslated region (5' UTR), exon, intron, 3' untranslated region (3' UTR), and coding sequence (CDS).
The dataset was created for benchmarking and developing models for transcript segmentation in the context of ab initio gene annotation. It supports both human-only and multispecies training setups, as well as held-out validation and test evaluation.
Each sample contains exactly three fields:
dna_sequencelabelsmetadata
Intended use
This dataset is intended for:
- training DNA language models for transcript segmentation
- fine-tuning pretrained genomic foundation models
- benchmarking nucleotide-level and gene-structure-aware segmentation methods
- evaluating generalization from human-only to multispecies training
- studying segmentation of both protein-coding and long non-coding transcripts
It is particularly suitable for methods that operate on long genomic or transcript-derived sequences and output per-nucleotide labels.
Dataset configurations
The repository contains four configurations.
| Config | Split | Description |
|---|---|---|
train-human |
train |
Human-only training dataset. Sequence length is capped at 250 kb. One transcript per gene is retained, chosen as the isoform with the longest cumulative exon length. |
train-multi-specie |
train |
Multispecies training dataset spanning human and additional mammalian assemblies. Sequence length is capped at 250 kb. One transcript per gene is retained, chosen as the isoform with the longest cumulative exon length. |
val-human |
validation |
Human validation dataset. Sequence length is capped at 250 kb. One transcript per gene is retained, chosen as the isoform with the longest cumulative exon length. |
test-human-complete |
test |
Human test dataset containing full transcript sequences from chromosome 20 of the T2T human genome, with no truncation by length and with all annotated transcripts of each gene retained. |
The dataset follows different transcript selection rules for training, validation, and test.
test-human-completecontains all transcripts of each gene from chromosome 20 of the T2T human genome.train-human,train-multi-specie, andval-humancontain only one transcript per gene, selected as the transcript with the longest cumulative exon length.
Human chromosomes are partitioned so that chromosomes 8, 20, and 21 are held out from human training. In this setup:
- human training data exclude chromosomes 8, 20, and 21
- human validation data are drawn from held-out human chromosomes
- the full-length transcript version of human chromosome 20 is used for the
test-human-completedataset
For the multispecies dataset:
- all chromosomes are included for non-human species
- human examples follow the same held-out chromosome policy described above
Data schema
Each row has exactly three columns.
dna_sequence
A string containing the DNA sequence for the example.
- Type:
string - Alphabet: uppercase DNA characters (only A, T, C and G)
labels
A nested array of nucleotide-level target annotations aligned to dna_sequence.
- Type: nested numeric array
- Shape: sequence-length by class-dimension
- Interpretation: per-nucleotide multilabel or multiclass segmentation targets used for transcript structure prediction
The target class order is:
["5UTR", "exon", "intron", "3UTR", "CDS"]
metadata
A compact string encoding transcript-level annotation in the following format:
<type>|<gene_name>|<transcript_name>|<strand>|<start>:<end>|<genome>
Metadata fields
The metadata field contains biologically interpretable attributes packed into a single string. The meaning of each component is described below.
1. type
Transcript class.
Typical values include:
mRNAlnc_RNA
This field indicates whether the transcript is protein-coding or long non-coding.
2. gene_name
Gene identifier or gene name associated with the transcript.
Typical values look like:
gene-LOC124908100
This field identifies the parent gene for the transcript.
3. transcript_name
Transcript identifier.
Typical values look like:
rna-XR_007089385.1- transcript accession-like names from reference annotations
This field identifies the specific transcript isoform represented by the example.
4. strand
Genomic strand orientation.
Allowed values are typically:
+-
This field indicates whether the transcript is encoded on the forward or reverse strand relative to the reference assembly.
5. start:end
Genomic coordinate interval associated with the example.
Example:
23090370:23092686
This field stores the coordinate span as:
start: integer genomic start positionend: integer genomic end position
6. genome
Genome or assembly identifier associated with the example.
Typical values are assembly accessions such as:
GCF_009914755.1GCF_000001635.26
This field is especially relevant for the multispecies dataset, where it identifies the source assembly of the transcript example.
Multispecies training dataset
The train-multi-specie configuration includes data from 39 mammalian assemblies.
| Assembly | Species |
|---|---|
| GCF_000952055.2 | Aotus nancymaae |
| GCF_002263795.3 | Bos taurus |
| GCF_000767855.1 | Camelus bactrianus |
| GCF_000002285.3 | Canis lupus familiaris |
| GCF_000151735.1 | Cavia porcellus |
| GCF_001604975.1 | Cebus imitator |
| GCF_000283155.1 | Ceratotherium simum simum |
| GCF_000276665.1 | Chinchilla lanigera |
| GCF_000260355.1 | Condylura cristata |
| GCF_002940915.1 | Desmodus rotundus |
| GCF_000151885.1 | Dipodomys ordii |
| GCF_002288905.1 | Enhydra lutris kenyon |
| GCF_000308155.1 | Eptesicus fuscus |
| GCF_000002305.2 | Equus caballus |
| GCF_018350175.1 | Felis catus |
| GCF_000247695.1 | Heterocephalus glaber |
| GCF_009914755.1 | Homo sapiens |
| GCF_000236235.1 | Ictidomys tridecemlineatus |
| GCF_000280705.1 | Jaculus jaculus |
| GCF_000001905.1 | Loxodonta africana |
| GCF_001458135.1 | Marmota marmota |
| GCF_000165445.2 | Microcebus murinus |
| GCF_000317375.1 | Microtus ochrogaster |
| GCF_000001635.26 | Mus musculus |
| GCF_900095145.1 | Mus pahari |
| GCF_002201575.1 | Neomonachus schauinslandi |
| GCF_000292845.1 | Ochotona princeps |
| GCF_000260255.1 | Octodon degus |
| GCF_000321225.1 | Odobenus rosmarus divergens |
| GCF_009806435.1 | Oryctolagus cuniculus |
| GCF_000181295.1 | Otolemur garnettii |
| GCF_016772045.2 | Ovis aries |
| GCF_000956105.1 | Propithecus coquereli |
| GCF_003327715.1 | Puma concolor |
| GCF_036323735.1 | Rattus norvegicus |
| GCF_000235385.1 | Saimiri boliviensis boliviensis |
| GCF_000181275.1 | Sorex araneus |
| GCF_000003025.6 | Sus scrofa |
| GCF_000243295.1 | Trichechus manatus latirostris |
Loading examples
Load a configuration from the Hugging Face datasets library:
from datasets import load_dataset
train_human = load_dataset("shmelev/genatator-segmentation-dataset", "train-human")["train"]
train_multi = load_dataset("shmelev/genatator-segmentation-dataset", "train-multi-specie")["train"]
val_human = load_dataset("shmelev/genatator-segmentation-dataset", "val-human")["validation"]
test_human = load_dataset("shmelev/genatator-segmentation-dataset", "test-human-complete")["test"]
Access one example:
sample = train_human[0]
print(sample["dna_sequence"])
print(sample["labels"])
print(sample["metadata"])
Summary
genatator-segmentation-dataset is a long-context, nucleotide-level transcript segmentation dataset for DNA language models and related genomic sequence models. It includes human-only and multispecies training resources, a human validation set, and a full-length human test set, all formatted for direct use with modern machine learning pipelines.
- Downloads last month
- 32