text stringlengths 1 2.15M | meta dict |
|---|---|
An innocent Toronto man who was held at gunpoint during a dramatic takedown outside a grocery store because he looked like a murder suspect is demanding an apology from the city's police chief.
Toronto police admit it was a case of "mistaken identity," but the service is standing by the emergency task force officers who detained Dante Newman last week.
"When you're dealing with people wanted for the most serious crimes, you have to take every necessary precaution," said Meaghan Gray, a spokesperson for the Toronto Police Service.
You know that you're innocent, but to this day I still feel like I did something wrong. - Dante Newman
Newman, 20, was leaving a FreshCo with groceries on the afternoon of Nov. 15 in the city's St. James Town area when he says two officers hopped out of their cruiser, pointed their guns at him and shouted at him to stop.
One officer "had me at gunpoint, and he told me to get onto the floor, because I was wanted for murder," Newman told CBC Toronto on Thursday.
The college student said the experience "was so real."
"You know that you're innocent, but to this day I still feel like I did something wrong, but I know that I didn't," said Newman.
Newman, 20, was held at gunpoint during the arrest. (Mehrdad Nazarahari/CBC)
Officers were actually looking for Kyler Johnson for an "ambush-type" killing last summer in the nearby Corktown area.
Johnson, 23, was arrested in London, Ont., 24 hours after the confrontation with Newman. Johnson is charged with first-degree murder in the Aug. 19 slaying of a 22-year-old man.
Newman said the officers searched him and found his wallet, phone and chocolate he had just bought.
"It's something that shouldn't have happened ... and I can't really get over it," he said.
Homicide detectives, called to the scene, let him go after 90 minutes.
Newman claims the officers told him: "Look at it from our perspective; we're just doing our job and it happens every day."
Still, he believes police aren't supposed to make mistakes like this.
"I'm a Canadian citizen, and I didn't get an apology from the people who I'm supposed to expect to protect me," Newman said, adding the experience has rocked his faith in police.
I'm a Canadian citizen and I didn't get an apology from the people who I'm supposed to expect to protect me. - Dante Newman
Gray says the family can file a complaint with the Office of the Independent Police Review Director (OIPRD) to ensure a "thorough" investigation looks into Newman's arrest.
The OIPRD is responsible for examining public complaints and conducting an independent review under the Police Services Act.
"There is a procedure that needs to be followed when an allegation of wrongdoing on the part of the police officers is put in," said Gray.
"We do need to do that proper review before we can decide next steps, from an officer disciplinary perspective or reaching out to the family."
Newman's mother, Vanessa St. Louis, said she was shocked by the incident and appalled at how police handled it.
"They got to be certain that they have the guy. You don't just get a person that's walking out of a grocery store and have them feeling traumatized," she said. | {
"pile_set_name": "OpenWebText2"
} |
Owen Dew’s summer vacation ends almost as soon as he gets back from the Canadian Lacrosse Association Junior B Box Championships in Winnipeg this week.
The 17-year-old Glendale High School grad will be leaving for South Carolina where he will be play NCAA Division 2 lacrosse at Limestone College, enrolled in a four-year Bachelor program majoring in sports management.
In 2018, Dew was selected by Six Nations Arrows in the first round, 9th overall of the Ontario Junior A Entry Draft – the highest box lacrosse goalie selected. He signed with the Arrows for his first year of Junior A, but saw limited game time as a rookie goalie backing up a fifth-year veteran.
“I played a little bit last year, but being a younger guy they went with the older goalie so I didn’t really get too much playing time. They wanted me to get the development. I got practices and I think maybe 20 minutes of actual game.
“It’s a five-year junior program, 16-21, so even being on the team and getting a roster spot at 16 was good enough, there was nothing wrong with a backup role. I just wanted to put in the grind, ride that out. A lot of guys do what I did this season, they do Junior B then go back.”
Dew’s prospects had not changed in 2019 when the team brought in another 19-year-old veteran goalie.
“Most teams do that,” he noted.
Tillsonburg’s Owen Dew, a Glendale High School grad, earned athletic and academic scholarships to attend Limestone College in South Carolina where he will be playing men’s field lacrosse while majoring in Sports Management. (Chris Abbott/Tillsonburg News)jpg, TN
So to get more game time, Dew was part of a multi-player transfer being sent to the Seneca WarChiefs in Cattaraugus, New York, to play in the First Nations Junior B Lacrosse League with teams from the US and Canada.
“It was between another Six Nations Junior B team, or the WarChiefs,” said Dew. “It wasn’t like an official trade.”
As a goalie, he had developed while practicing with the Junior A team, but game situations – dealing with nerves and pressure situations – are different, and playing Junior B this season was beneficial.
“This year I had to deal with that a little bit and pulled out some tight games. So in the mental aspect, I developed a lot.”
One of the biggest changes might have been his travel time – three hours to practice and games, multiple times every week during the season, with road games as far as Cornwall.
“Practice from 8-10, then three-and-a-half hours home,” he smiled.
The WarChiefs finished an undefeated 2019 season, and won their 6th First Nations Junior B Championship. With that came a berth at the Founders Cup (Canadian Lacrosse Association Junior B Box Championship) in Winnipeg, August 13-19, with teams from B.C., Alberta, Saskatchewan, Ontario, First Nations and Quebec. All games will be live streamed via webcast.
The WarChiefs have been to the Founders Cup five times, winning three silvers and two bronze, but it will be Dew’s first trip.
“It sounds a little weird – going to the Canadian Nationals – because we’re a team from New York. Our league is a First Nations league and we’re a member of the CLA even though the league is mostly in the States.
“Some of the guys, the 21-year-olds, they have a shelf full of silver and bronze medals… they’re in their last year and they want it to be their year.”
The WarChiefs have three goalies including Dew, who split most of the season with one of the other goalies.
“That team’s mainly about development. Everybody has the talent, it’s just mixing everybody up together and really growing as a team. So we kind of split roles.”
At the championship, Dew said it will come down to whoever is ‘hot’, and their different styles.
“It depends on the shooters of the other teams and whoever matches up best against them.”
Dew’s Ontario Junior A playing rights were traded at the deadline to the Mimico Mountaineers, where he hopes to earn a roster spot in 2020 with a season that starts after field lacrosse ends.
Field lacrosse
In field lacrosse (outdoor), Dew has had success playing different positions – transition (midfield) and defence.
The 17-year-old Ontario Scholar received athletic and academic scholarships to attend Limestone College in Gaffney, South Carolina this fall where he will major in Sports Management, a four-year Bachelor program.
Glendale High School’s Guidance Department and teachers provided valuable support to help him successfully meet the challenging US college and SAT testing requirements, and he was grateful for that support.
“I got a really good offer (from Limestone College), it was an offer I couldn’t really turn down. I had kind of narrowed it down to about 10 schools I was serious about and contacted them. A few didn’t respond, a few I met the coaches and I just wasn’t too enthusiastic about, and I kept narrowing it down until I was at three schools. In February, right after exams, we planned a trip to go down to all three of them, spend a night on campus, get a tour, look at the facilities and watch them play.”
Tillsonburg’s Owen Dew signs with Limestone College Saints, South Carolina, where Dew will be majoring in Sports Management and playing men’s field lacrosse. (Contributed photo)jpg, TN
It turned out to be a two-school visit.
“I based my decision off my visit and how my next four years would go for me, being with those guys and those coaches, and all of the program choices. That was a big thing too. When I was contacting schools I had one specific program that I wanted to be in, and if the school didn’t have that, I didn’t contact them because I’m focused on academics too.
“Education has always kind of a priority – it’s hard getting home late, but I always made sure to get to class after late-night practices. You get used to it. Going to a good school and getting a good education has always been a priority… for longer than lacrosse has. Maybe five years ago one of my coaches talked about scholarships and got my whole team looking into that, so that’s kind of where that fire got lit. But sports never overcame the education side of it.”
Dew did apply to three Canadian schools, and was accepted at each. But the scholarship route was even more appealing.
“My last two choices were a perfect balance of academics and athletics. I think it (Limestone) was a better offer and I just kind of liked the atmosphere better. They had a great atmosphere to be around. When I was walking around with the team on campus, people knew who the lacrosse team was… that was really cool. Even the sport program in general, all the athletes knew each other and had a bond that I wanted to be part of. It was really interesting to see, at a school like that, all the students interacting with each other.”
The moment he signed for the scholarship, that was when he knew the long hours on the road, the studying and school work, were all worthwhile.
“It was really hectic there for a while. Once I accepted, and signed, it was a huge weight off my chest. I realized I had been putting in a ton of effort, and not really getting much back the last few years, but I kind of got it all back at once, and that was just a great feeling to know that it all paid off in the end.”
Limestone Saints men’s field lacrosse team, playing in the NCAA D2 Carolinas Conference, have won the US National Championship five times in the past, going undefeated last season. Their only loss was in the National Championship and they are currently nationally ranked No. 1 going into the 2020 season.
“Gaffney’s not a huge place. I wasn’t really looking for a huge size – or too small. It was really just kind of a ‘home’ feeling. I didn’t really want to go to a big inner city school and I didn’t want to go to a school in the middle of nowhere, either. The town’s a great size. The whole town goes out to watch the games.”
Although he played multiple sports in Tillsonburg, he won’t be playing football in Gaffney.
“Football’s done,” he smiled. “I miss that a lot. It was a great four years. Hockey, I remember it but I stopped a long time ago. It was great when I was a kid but I just decided I like lacrosse a lot more and I wanted to pursue that seriously. I think quitting hockey paid off in the end, it was one of those things…
“Football was a great experience, a great way to get through four years of high school. It always gave you something to look forward to in football.” | {
"pile_set_name": "Pile-CC"
} |
When the Flames hit the ice for their pre-game warm-ups, two notable faces were missing. First of all, the will-he-or-won't-he-play question that was Curtis Glencross was answered. While he did participate in the optional pre-game skate in the morning, he did not dress for warm-ups. The winger is suffering from lower body soreness and is day-to-day. The other forward missing was Matt Stajan. The pivot also took part in the pre-game skate but was absent on Wednesday evening. With the two missing, the Flames coaching staff opted to use seven defenceman and 11 forwards against the Avs.
HORAK HAMMERS IT HOME
Down 1-0 despite outshooting the Avs 12-2, the Flames had an unlikely hero come to the rescue. Known more for his playmaking abilities and defensively responsible plays, Roman Horak managed to tie the game - and score his first NHL goal in the process - with an incredible individual effort. After J.S.Giguere stopped Alex Tanguay's initial shot, Horak came steaming in and whacked away at the rebound until it flew over the netminder's glove. He managed to score despite the fact he was sitting on the ice with former Flame Chuck Kobasew trying to shove him out of the way - the epitome of unwavering determination.
While scoring the first of career was great, there was an added bonus. The assists on Horak's equalizer? Tanguay and Jarome Iginla. Talk about a memorable first goal for the youngster.
BOOM-BOOM RETURNS
After much speculation over his possible return to the lineup, defenceman Anton Babchuk dressed for his third game this year. Babchuk has been a healthy scratch for the majority of the campaign - with Derek Smith playing with Cory Sarich on the Flames third defensive pairing - due to the fact the coaching staff has felt he hasn't played within the team structure. Head coach Brent Sutter said he wanted to see the 27 year-old use his howitzer of shot more and he answered back by sending a hard slapper towards net during his first shift.
In 9:36 of ice time, Babchuk had an assist, two hits, one takeaway and two blocked shots. He is now just two points shy of hitting 100 in his career.
FIRST PERIOD SHOOTING GALLERY
The Flames have spoken at great length about firing as many shots on net as they possibly can and they executed that game plan perfectly in the first frame on Wednesday night. By the end of the first period, Calgary had peppered Giguere with 21 shots. In addition to those that landed on net, the Flames had three attempts blocked by the Avs and five shots miss the net.
After 60:00, the Flames had 34 shots on net and 16 attempted shots.
POWER PLAY FINALLY CLICKS
A major issue for the Flames in previous games has been a lack of production from their power play. Despite having nine opportunities with the man advantage in their last two contests, they couldn't find the back of the net.
That trend changed in the second period when Rene Bourque was able to bat a loose puck into the net during the Flames second power play of the night. The goal came after a great passing play that opened up passing lanes, showcasing how successful they can be when their power play tactics are focused around constant movement. | {
"pile_set_name": "Pile-CC"
} |
First Twitter goes down; now Whole Foods. How will hip young techies survive?
Not quite a complete shutdown, but Whole Foods shoppers have been texting and tweeting about register shutdowns at stores in several states. Some where half the registers were closed, others completely unable to ring up the items.
Whole Foods responded to our request for information with a statement: Corporate Vice President Brooke Buchanan says, “We’ve experienced an unforeseen log-in issue within our point of sale systems, and registers are resetting and coming back online.”
As we saw Friday with the DDoS on web sites, the problems at Whole Foods seem to be slowing. Perhaps more registers are coming back online. Unlike Friday, this does not seem to be a targeted attack of any kind, more like a company-wide computer glitch.
We’ll continue to follow the story.
Scott shops on Twitter: @scottbudman | {
"pile_set_name": "OpenWebText2"
} |
Q:
Intellij show warnings as errors
A feature I like in eclipse the most is that it easily shows me all my errors and warnings in the code (in a list)
Also - by each file there is a mark whether the file has warnings/errors
In Intellij I found it rather challenging...
So for all the Intellij experts out there -
Is there a way so show warnings in a list (I saw something similar in the messages toolbar but it dissapears when there are no compilation errors)
How can I see if a file has warnings without looking into it's contents?
Thanks!
A:
Also I like error/warning list that appears when trying to commit file into Subversion. If any errors or warnings present in file, IDEA shows popup window with Review button. This button opens Message sub-window with very handy and good-looking errors/warnings list.
P.S. Also may be helpful Build -> Rebuild Project
P.S.2. Also see about displaying warnings here: Warnings in IntelliJ IDEA v12
A:
I think what you're looking for is "Inspect Code" under the "Analyze" menu. It allows you to specify which inspections you want to run (called an Inspection Profile) and on what set of files, and puts them all in a window to let you look through them and resolve them.
See Code Inspection in the documentation for more information.
| {
"pile_set_name": "StackExchange"
} |
Most airsoft enthusiasts don’t realize that magazines should be periodically replaced. Faulty magazines are the bane of the airsoft experience, but Umarex USA has the perfect solution to help you be prepared. We offer a wide selection of airsoft pistol magazines to suit some of the most popular gun models in our inventory. This selection features mags from our own line and some of the finest name brands in the industry. Best of all, we provide airsoft pistol mags at all price points. Shop from our selection today to explore magazines for Elite Force, Heckler & Koch, and Legends airguns.
Deciding between magazines can be daunting or difficult, but the decision usually comes down to shooter preference. Low-capacity mags provide the closest possible experience to realistic combat, and they also have a realistic loading frequency to help you hone your skills under pressure. We supply a variety of low-cap airsoft pistol magazines to suit any need or preference. We offer mags suited to Elite Force competition race guns that fire up to 16 rounds. We offer mags suited to Elite Force 1911 airsoft pistols with blowback that fire up to 14 rounds. We also offer magazine discs suited to Elite Force H8R revolvers. Don’t let yourself get caught without ammo. Stay in the game with extra mags!
Airsoft enthusiasts love CO2-powered guns manufactured by Heckler & Koch, because they are quiet, easy to use, and require little to no cocking effort. Do you have a jammed or faulty mag on your favorite gun? Explore our airsoft pistol mags to find a low-cap solution today. We supply replacement mags for HK USP and HK45 airsoft pistols and variations. Don’t forget to stock up on extra shells for your Elite Force Legends Smoke Wagon airsoft revolver! Each pack comes with six shells, so you can spend less time prepping and more time shooting.
Enjoy notifications about gun giveaways, discounts, and airsoft competitions by signing up for our newsletter. Please contact us with any questions or concerns, so one of our experienced and friendly representatives can provide further assistance or additional information. Plus, take advantage of our free shipping offer when you spend $139 or more.
Company Information
You must be 18 years of age or older, and conform to all laws governing the use and ownership of air guns in your local area. For more on safety and regulations, click here.
* Free Shipping Available in Non-restricted Locations. Click for Details. | {
"pile_set_name": "Pile-CC"
} |
Introduction {#S1}
============
Breast cancer is the most common cancer in women and the second most common cancer overall ([@B36]). Despite major advances in diagnosis and treatment of cancer in recent years, metastasis and development of resistance to cancer therapies continues to be a challenge, causing over 90% of all cancer-related deaths ([@B8]). A major contributing factor to metastasis and drug resistance is the heterogeneity and plasticity of the cells within tumors ([@B21]). Epithelial-to-mesenchymal transition (EMT), is a developmental process that can be hijacked by cancer cells ([@B112]; [@B72]; [@B83]). Generally, cells undergoing EMT, acquire increased migration and invasive properties and show increased resistance to apoptosis ([@B85]; [@B13]). Through these processes, EMT is considered a major mediator of phenotypic plasticity in cancer cells, metastatic formation and drug resistance ([@B63]; [@B87]; [@B3]; [@B74]; [@B62]). Recently, hybrid E/M (or partial EMT) cells have been shown to have even more metastatic and stem cell potential compared to the full epithelial or mesenchymal phenotype ([@B76]). A reversed program, mesenchymal-to--epithelial transition (MET) is considered to facilitate colonization in secondary sites and reverse the plastic mesenchymal phenotype back to an epithelial state ([@B62]). This, however, is debated and further studies will increase our knowledge of the role of EMT/MET in cancer progression and metastasis.
EMT can be initiated through intrinsic factors such as expression of EMT related transcription factors (SNAI1, SNAI2, TWIST1, ZEB1, or ZEB2), cadherin switch from E-cadherin (CDH1) to N-cadherin (CDH2) or through epigenetic mechanisms. It can also be brought on by extrinsic factors derived from the microenvironment, such as secreted soluble factors: transforming growth factor-β (TGF-β), epidermal growth factor (EGF), fibroblast growth factors (FGFs), hepatocyte growth factor (HGF) or Wnt signaling factors ([@B72]; [@B78]; [@B22]; [@B106]; [@B107]).
Non-coding RNAs (ncRNAs) are among intrinsic regulators of EMT ([@B111]). It is increasingly apparent that the ncRNAs are crucial in normal development and disease, but its mechanistic mode of action is largely unknown ([@B60]). The two major classes of non-coding RNAs are long non-coding RNA (lncRNAs) and microRNA (miRNAs). Accumulating evidence suggests that lncRNAs function in a broad range of cellular processes such as cell growth, survival, migration, invasion and differentiation ([@B65]; [@B95]; [@B23]; [@B30]). LncRNAs are defined by the size of their transcripts and are longer than 200 nucleotides (nt), with no protein-coding function ([@B27]). Unlike microRNAs, lncRNAs are poorly conserved, but function in a regulatory network at the transcriptional, post-transcriptional, and translational level. miRNAs are 22 nt long RNA molecules that regulate expression post-transcriptionally primarily by binding to three prime untranslated region (3′UTR) of target genes ([@B5]).
The imprinted DLK1-DIO3 locus located on chromosome 14 contains three paternally expressed protein-coding genes (*DLK1*, *RTL1*, *DIO3*) and numerous maternally expressed non-coding genes, including the lncRNA maternally expressed gene 3 (*MEG3*), and a cluster of over 50 miRNAs ([@B113]; [@B24]; [@B7]; [@B55]).
The DLK1-DIO3 locus has been described as an important contributor to pluripotency and stemness in embryonic stem cells (ESCs) ([@B52]). It discriminates between mouse induced pluripotent stem cells (iPCS) and mouse ESCs, where genes from the locus were strongly repressed in iPSC clones compared to ES clones ([@B58]; [@B92]). Furthermore, activation of maternally expressed genes from the locus is a strong indicator of the developmental potential of iPSC ([@B53]). miRNAs from the DLK1-DIO3 locus have been shown to promote pluripotency by inhibition of differentiation and stimulation of self-renewal in mouse ES cells ([@B69]) and were found to be increased in tumor-originating cancer cells from lung adenocarcinoma ([@B103]).
*MEG3* is a potential tumor suppressor gene in several cancer types, mainly through the observation that *MEG3* expression is lower in various tumor tissues compared with non-tumor tissues of the same origin ([@B89]; [@B96], [@B94]; [@B110]; [@B14]; [@B68]). The tumor suppressor role of *MEG3* is ascribed to stabilization of p53 with inhibition of proliferation and promotion of apoptosis ([@B114], [@B113]; [@B115]; [@B104]; [@B94]).
*MEG3* was reported to positively regulate EMT in lung ([@B99]) and ovarian ([@B67]) cancer. Furthermore, *MEG3* has been shown to contribute to the development of osteosarcoma through increased migration, invasion and decreased apoptosis ([@B105]). Higher levels of *MEG3* were detected in plasma from colorectal cancer patients compared with non-cancerous controls ([@B57]).
D492 is a primary breast epithelial cell line, immortalized with the E6 and E7 oncogenes from the human papilloma virus 16 ([@B40]). Therefore, the p53 protein, which mediates the previously described tumor suppressor role of *MEG3*, is repressed in this cell line. D492 can generate both luminal and basal/myoepithelial cells in monolayer and 3D culture, expressing luminal or myoepithelial keratins such as keratin 19 and keratin 14, respectively. Furthermore, when D492 cells are co-cultured with endothelial cells, they, can generate spindle-shaped colonies with EMT phenotype. D492M (mesenchymal) was established from one such spindle-shaped colony ([@B91]). D492M is a phenotypically stable EMT cell line. It has lost epithelial markers such as keratins, E-cadherin and TP63, and gained expression of mesenchymal markers such as N-cadherin ([@B91]; [@B45]). D492M has acquired classical properties of cancer stem cells, such as increased CD44/CD24 ratio, anchorage independent growth, resistance to apoptosis and increased migration/invasion ([@B91]). D492 serves as a model for branching morphogenesis and together D492 and D492M represent a unique EMT model of isogenic cell lines with an epithelial and mesenchymal phenotype, respectively ([@B11]). The ability of D492 to undergo mesenchymal transition upon endothelial stimulation makes it a valuable cell model to study EMT induced by extrinsic factors, although it is important to note that neither D492 nor D492M are tumorigenic in mice.
In this study, we describe a new role for the DLK1-DIO3 locus in EMT and phenotypic plasticity of breast cells. Following EMT in breast epithelial cell lines, expression of the ncRNAs at the DLK1-DIO3 locus was increased. In addition, *MEG3* was highly expressed in stromal cells in breast tissue and its expression correlated with decreased survival in breast cancer. Moreover, increased expression of the ncRNAs at the DLK1-DIO3 locus in a breast epithelial progenitor cell line promoted cellular plasticity and induced partial EMT. Collectively, our study provides a further understanding of the role of the DLK1-DIO3 locus in cellular phenotype of breast cells and might provide important insight into novel therapeutic targets aimed at overcoming heterogeneity and therapy resistance in breast cancer.
Materials and Methods {#S2}
=====================
Cell Lines {#S2.SS1}
----------
Both D492 and D492M were cultured in H14 medium, as described previously ([@B40]; [@B91]) in flasks coated with collagen I (Advanced BioMFatrix, 5005-B). HEK-293T cell were cultured in Dulbecco's Modified Eagle Medium (DMEM), high glucose, GlutaMAX (TM), pyruvate (Gibco, 31966), supplemented with 10% Fetal bovine serum (FBS), penicillin and streptomycin (Gibco, 15140-122). Primary Human umbilical vein endothelial cells (HUVECs) were obtained from Landspitali, University Hospital in Reykjavik, Iceland, (with informed consent, approved by Landspitali Ethical Committee No. 35/2013), cultured in Endothelial Growth Medium 2 (EGM2) media (Lonza, CC-3162) supplemented with growth factors and 5% FBS, further referred to as EGM5 medium as previously described ([@B91]). HMLE ([@B28]) is epithelial progenitor cell line, from which was derived mesenchymal cell line HMLEmes after stable induction of EMT-TF ([@B63]). HMLE and HMLEmes were cultured in chemically defined HMLE media, containing DMEM/F12 with penicillin and streptomycin and growth factors Insulin (Sigma, I1882) 10 μg/ml, EGF (Peprotech, AF-100-15) 10 ng/ml, Hydrocortisone (Sigma, H0888) 500 ng/ml.
Primary human luminal-epithelial cells (LEP), myoepithelial cells (MEP), breast endothelial cells (BRENCs) and fibroblast were isolated from breast reduction mammoplasties (with informed consent, approved by the Icelandic National Bioethics Committee VSN-13-057) as previously described ([@B91]) and maintained in chemically defined medium 3 (CDM3) and chemically defined medium 4 (CDM4) as previously described ([@B77]; [@B49]). All cells were maintained in an incubator with 5% CO~2~ at 37°C.
3D Cultures/Mammosphere Assays {#S2.SS2}
------------------------------
3D cultures were carried out in a 48-well plate format (Corning, 353078) in growth factor reduced reconstituted basement membrane rBM (further referred to as Matrigel, Corning, 354230). 5--10 × 10^3^ cells were seeded in 150 μl of Matrigel per well. Plate was incubated in 5% CO~2~ at 37°C for 15 min to solidify the Matrigel and then 300 μl of H14 media was added on top. The cells were grown for 3 weeks and pictures were taken on day 1, 7, 14, and 21. Cell culture media was changed three times per week. The colonies were quantified at day 14. The total number of cells was converted into percentage.
For co-culture experiments, 0.5 × 10^3^ of the epithelial cells were co-cultured with 1 × 10^5^ of endothelial cells (HUVECs) and were resuspended in 150 μl of Matrigel. Plate was incubated in 5% CO~2~ at 37°C for 15 min to solidify the Matrigel and then 300 μl EGM5 media was added on top. HUVECs cultured in Matrigel are viable, however, quiescent, having supporting role in the epithelial cells' proliferation. The effect of *MEG3* was quantified by counting all colonies bigger than 100 μm.
Total RNAseq and Analysis of the Data {#S2.SS3}
-------------------------------------
The gene microarray expression analysis from D492 and D492M was published previously from our group by Sigurdsson and colleagues ([@B91]) and the total RNA-sequencing comparing D492 and D492M was published by Halldorsson and colleagues ([@B41]).
The RNA was extracted using Tri-Reagent (Thermo Fisher Scientific, AM9738) from 5 replicates for each cell line. Whole Transcriptome Sequencing of D492M^KD--CTRL^ and D492M^KD--MEG3^ was performed in deCODE genetics (Reykjavik, Iceland). RNA sequencing reads were mapped to the reference genome (Ensembl primary assembly, version GRCh38) using STAR version 2.6.1 ([@B25]). The program htseq-count ([@B2]) was used to quantify how many reads match each gene in an annotation file (Ensemble version GRCh38.96). The data from htseq-count was imported into R ([@B82]) and differential expression (DE) analysis on D492M^KD--CTRL^ vs D492^KD--MEG3^ was performed using DESeq2 ([@B61]). Prior to DE analysis, genes with expression less than two reads were discarded. *P-*values were corrected for multiple testing using the false discovery rate (FDR) method. To compare gene expression from D492M^KD--CTRL^ vs D492M^KD--MEG3^ a volcano plot was generated. *P* value cut-off of 0.05 was applied. Volcano plot over all data (*p* \< 0.05) was made in R using the EnhancedVolcano package from BioConductor. The top ten most upregulated and downregulated genes according log2 fold change were labeled. Gene Set Enrichment Analysis (GSEA) was applied to identify enrichment of gene signatures. Comparative analysis was investigated using the "Hallmark" database. The list of significantly expressed pathways is presented as a bar plot.
Quantitative RT-PCR Analysis {#S2.SS4}
----------------------------
Total RNA was extracted with Tri-Reagent (Thermo Fisher Scientific, AM9738). 1 μg of RNA of each sample was reverse transcribed into complementary DNA (cDNA), using Random Hexamers (Thermo Fisher Scientific, N8080127) and SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific, 18090-200) kit and subjected to quantitative real time PCR (qRT-PCR) using Sybr Green dye Luna^®^ Universal qPCR Master Mix (NEB, M3003L) or TaqMan probes Luna^®^ Universal Probe qPCR Master Mix (NEB, M3004L) according to manufacturer's protocol. *GAPDH* was used as control for gene expression. For assaying the relative expression of each gene, the 2^--ΔΔCt^ was determined using an ABI 7500 instrument (Applied Biosystems).
### List of Primers {#S2.SS4.SSS1}
TaqMAN: *ZEB1* (Thermo Fisher Scientific, Hs00232783_m1), *ZEB2* (Thermo Fisher Scientific, Hs00207691_m1), *SNAI1* (Thermo Fisher Scientific, Hs00195591_m1), *SNAI2* (Thermo Fisher Scientific, Hs00950344_m1), *TWIST1* (Thermo Fisher Scientific, Hs01675818_s1), *GAPDH* (Thermo Fisher Scientific, 4326317E).
SYBR Green: *KRT14* (IDT, Hs.PT.58.4592110), *KRT19* (IDT,Hs.PT.58.4188708), *MEG3* ex 10-11 (IDT, Hs.PT.58.25190740), *GAPDH* (IDT, Hs.PT.39a.22214836), *KRT5* (IDT, Hs.PT.58.14446018), *TP63* (IDT, Hs.PT.58.2966111), *CDH3* (IDT, Hs.PT.58.39234242).
Small RNAseq {#S2.SS5}
------------
The Microarray of small RNA data was published previously by our group by Hilmarsdottir and colleagues ([@B45]) and the small RNAseq data was published previously by Briem and colleagues ([@B10]).
miRNA qRT PCR {#S2.SS6}
-------------
Total RNA was extracted with Tri-Reagent (Thermo Fisher Scientific, AM9738). The RNA was reverse transcribed using miRCURY LNA RT Kit (Qiagen, 339340) for cDNA synthesis reactions, according to manufacturer's protocol. Quantitative RT-PCR analysis of miRNAs was performed using miRCURY LNA SYBR Green PCR Kit (Qiagen, 339346), according to manufacturer's protocol. Gene expression levels were quantified using primers for: hsa-miR-127-3p (Qiagen, YP00204048), hsa-miR-409-3p (Qiagen, YP00204358), hsa-miR-411-5p (Qiagen, YP00204531), hsa-miR-493-3p (Qiagen, YP00204557). Normalization was done with U6 snRNA (Qiagen, YP00203907). The 2^--ΔΔCt^ was used determined using ABI 7500 instrument (Applied Biosystems) to calculate the relative expression of each gene.
Allele Specific Expression Analysis {#S2.SS7}
-----------------------------------
Total RNA was extracted with Tri-Reagent (Thermo Fisher Scientific, AM9738) and reverse transcription done using 1 μg of DNase I-treated total RNA using random hexamers (Thermo Fisher Scientific, N8080127) and SuperScript II Reverse Transcriptase (Thermo Fisher Scientific, 18064022) according to the manufacturer's instructions. PCR primers were designed using Primer3 and Pyrosequencing primers were designed using PyroMark Assay Design 2.0 (Qiagen). The reverse PCR primer had a 5′-biotin modification and was HPLC-purified. Primers were synthesized by IDT 5′-TGGCCTTTTCTTCTCCTGAA, 5′-/5Biosg/TGACACATGGAAAGCACCAT and sequencing primer 5′-TCCGGGGTTACTGCCCT-3′. Polymerase chain reactions were performed in 50 μl using 10 ng of diluted cDNA or 10 ng of DNA, 1 U DreamTaq DNA polymerase (Fermentas, EP0701), 1X PCR buffer, 200 μM of dNTPs and 0,5 μM of each PCR primer. The following PCR protocol was used: 94°C for 2 min, followed by 50 cycles of 94°C for 1 min, 60°C for 1 min, 72°C for 1 min and 72°C for 9 min. To check the quality of the amplification, PCR products were analyzed by gel electrophoresis. Pyrosequencing were sequenced using the PyroMark Q24 system (Qiagen), following the manufacturer's instructions. For the ASE SNP, DNA and RNA (cDNA) were pyrosequenced simultaneously. The proportions of individual alleles for the SNP were obtained using the PyroMark Q24 software version 1.0.10 (Qiagen). Genomic DNA from D492M was examined to confirm the heterozygosity.
Clinical Cohort {#S2.SS8}
---------------
RNA from breast cancer patients (diagnosed in the years 1987--2003) and relevant patient data was obtained from the Department of Pathology Landspitali -- The National University Hospital of Iceland. Informed consent was obtained from patients involved in this study according to the national guidelines. The study was approved by The Icelandic Data Protection Commission (2001/523 and 2002/463) as well as the National Bioethics Committee of Iceland (VSN-11-105-V2). 119 samples were used in the study assigned to the following subgroup: 33 luminal A, 24 luminal B, 22 Basal, 12 ErbB2, 10 Normal and 18 not classified. cDNA was synthesized from 2 μg of total RNA using Random Hexamers primers (Thermo Fisher Scientific, N8080127) and RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher). *MEG3* mRNA expression level was measured with the previously described qRT-PCR primers and TBP (Applied Biosystems, 4326322E) was used as a reference gene.
Western Blot Assay {#S2.SS9}
------------------
Cells were washed with cold Phosphate Buffered Saline (PBS) and lysed in radio immunoprecipitation assay (RIPA) buffer with phosphatase and protease inhibitors (Halt Protease Inhibitor Cocktail, Thermo Fisher Scientific, 78430) for 10 min on ice and scraped with cell scraper. Protein concentration was measured using Bradford reagent (BioRad, 5000002). Equal amounts of protein (5--15 μg) were separated on 10% NuPage Bis-Tris gels (Invitrogen, NP0301PK2) with NuPage MES running buffer (Thermo Fisher Scientific, NP0002) and transferred with NuPage Transfer buffer (Thermo Fisher Scientific, NP0006-1) to polyvinylidene fluoride (PVDF) membranes Millipore Imobilion-FL transfer membrane, pore size 0,45 μM (Millipore, IPFL00010). The membranes were blocked with Odyssey Blocking buffer (TBS) (LiCor, 927-500) and incubated with primary antibodies overnight at 4°C. List of antibodies: keratin 14 (KRT14; Abcam, Ab15461), keratin 19 (KRT19; Abcam, Ab7754), P-cadherin (CDH3; Cell signaling, CS2130), tumor protein p63 (TP63, Abcam, Ab124762), keratin 5/6 (KRT5/6; Invitrogen, 180267), Actin (Licor, 926-42212). Actin was used as loading control. Secondary antibodies were mouse or rabbit IRDey (Li-Cor 926-32213, 926-32212, respectively) used at 1:10.000 for 1 h at room temperature (RT) and detected and quantified using the Odyssey Infrared Imaging System (Li-Cor Fluorescent signal was detected by Odyssey image system (Li-Cor) and converted to gray scale.
Cell Migration Assay {#S2.SS10}
--------------------
Cell migration was examined by using trans-well Boyden chambers with 8 μm pore size (Corning, 353097). Briefly, 3 × 10^3^ cells were resuspended in 250 μl H14 medium and seeded on the trans-well inserts in 24-well plate (Corning, 353047). H14 media with 10% FBS was added to the lower chamber, below filter. Cells were incubated for 48 h in 5% CO~2~ at 37°C. Non-migratory cells from the upper part of the filter were removed with cotton swab and washed 3 times with 1× PBS. The filters were then fixed with methanol and stained with DAPI (Sigma, D9542-1MG). Cells were photographed in three random fields EVOS FL Auto 2 imaging system (ThermoFisher). Pictures were analyzed with ImageJ Software.
Low Attachment Assay {#S2.SS11}
--------------------
Anchorage independent growth was examined using 24-well ultra-low attachment plates (Corning, 3473). Briefly, D492 and D492M cells were single cell filtered and 500 cells/well were seeded into EGM5 media and cultured for 9 days. The growth of colonies was quantified under the microscope, counting all the colonies bigger than 40 μm.
Apoptosis Assay {#S2.SS12}
---------------
Resistance to chemically induced apoptosis was examined by inducing the cells with 10 μM camptothecin \[CPT, Sigma-Aldrich, C9911)\] in 96-well plate format (Corning, 353072). and quantified using IncuCyte Caspase-3/7 Reagents (Essen Bioscience, 4440) on IncuCyte Zoom (Essen Bioscience) according to the manufacturer's instructions.
Lentivirus Packaging and Transfection {#S2.SS13}
-------------------------------------
The packaging of lentiviral expression constructs into pseudoviral particles, was performed with the psPAX2 (Addgene, 12260) and PMDG.2 (Addgene, 12259) plasmids using Turbofect (Thermo Fisher Scientific, R05319) in HEK-293T cells. The supernatant was harvested after 48 and 72 h and filtered through 0,45 μm pore filter. For infection, cells were plated on T25 flasks, so they were 70--80% confluent following day and were infected with 1 ml of viral particles and 1 ml of fresh media in the presence of 8 μg/ml polybrene. Lentivirus-transduced cells were selected with antibiotics or sorted by FACS (Sony SH800), based on fluorescent dye to obtain stable pool of clones. The altered expression of *MEG3* was determined by qRT-PCR.
The list of lentiviral expression constructs (plasmids) used in the study and their selection marker (with final concentration in case of antibiotics): pLenti_sgRNA(MS2)\_zeo (Zeocin Invitrogen 4 μl/ml), pLenti_dCas9-VP64_Blast (Blasticidin, 2 μg/ml), pLenti_dCas9-KRAB_mCherry (mCherry fluorescence), SAM MS2-P65-HSF1 Plasmids (Hygromycin 1 μl/ml).
CRISPRi/CRISPRa {#S2.SS14}
---------------
To perform CRISPRi and CRISPRa, two vectors were used. First, vector with dCAS9 with effector domain KRAB (pLenti_dCas9-KRAB_mCherry, Genscript) and VP64 (pLenti_dCas9-VP64_Blast, Genscript) effector domain for CRISPRi and CRISPRa, respectively, was incorporated, using lentiviral transfection. Subsequently, vector with designed gRNA targeting specific site of our gene of interest *MEG3* was incorporated, in second round of lentiviral transfection. In case of gain of function studies with CRISPRa, one additional helper plasmid SAM (SAM MS2-P65-HSF1 Plasmids, Genscript) was used to further increase activation.
The sequence of gRNA for overexpression of *MEG3*: Guide 1: GCTCTCCGCCGTCTGCGCTA, the sequence of gRNA for downregulation of *MEG3*: Guide 2: GCGGGTGAGGGATCCTCTCGT, the sequence of gRNA for negative control: GCTTAGTTACGCGTGGACGA were cloned into pLenti_sgRNA(MS2)\_zeo (Genscript).
Statistical Analysis {#S2.SS15}
--------------------
Statistical differences of qRT-PCRs ([Figures 1E,F](#F1){ref-type="fig"}, [Figures 5A,B](#F5){ref-type="fig"}, and [Figures 7A--C](#F7){ref-type="fig"}) and functional assay ([Figures 8B--E](#F8){ref-type="fig"}) between samples were assessed with unpaired Student *t*-test. Statistical differences in [Figure 8A](#F8){ref-type="fig"} was calculated using multiple unpaired Student *t*-test per row. Statistical differences of quantifications of western blots ([Figures 7B,C](#F7){ref-type="fig"}) among samples were assessed using one-way ordinary ANOVA, followed by Tukey's multiple comparison test. Statistical differences in [Figure 4A](#F4){ref-type="fig"} (left) was calculated using Kruskal Wallis Test (one-way ANOVA on ranks). Statistical analysis of qRT-PCRs in [Figure 2](#F2){ref-type="fig"} were assessed with One-way ANOVA with Dunnett's multiple comparisons test. All statistical analyses were performed in GraphPad Prism. *P*-values below 0,05 were considered significant (^∗^*p* ≤ 0.05; ^∗∗^*p* ≤ 0.01; ^∗∗∗^*p* ≤ 0.001; ^\*\*\*\*^*p* ≤ 0.0001).
{#F1}
{#F2}
Results {#S3}
=======
*MEG3* Is Highly Expressed in Cell Lines With a Mesenchymal Phenotype and in the Stromal Compartment of Breast Tissue {#S3.SS1}
---------------------------------------------------------------------------------------------------------------------
D492 and D492M are isogenic cell lines with stem cell and mesenchymal properties, respectively. D492 cells acquire cuboidal shape in 2D culture, and form branching structures in 3D culture, akin to terminal duct lobular units (TDLU) in the breast. In contrast, D492M is elongated and spindle-shaped in 2D culture and in 3D culture it forms irregular mesenchymal-like colonies ([Figure 1A](#F1){ref-type="fig"}). We have previously shown that MIR203a and the MIR200 family are downregulated in D492M and their expression is essential for the epithelial phenotype ([@B45]; [@B10]). Of miRNAs upregulated in D492M, the miRNAs at the DLK1-DIO3 locus are prominent. A microarray analysis of miRNA expression demonstrated that 15 of the 25 most highly expressed miRNAs in D492M compared to D492 belong to the DLK1-DIO3 locus ([Figure 1B](#F1){ref-type="fig"}). Furthermore, small RNA sequencing revealed that 33 of the miRNAs belonging to the DLK1-DIO3 miRNA cluster have more than 1,5-fold increased expression in D492M compared to D492 ([Supplementary Figure 1](#SM1){ref-type="supplementary-material"}). Moreover, total RNA sequencing of D492 and D492M, revealed that *MEG3* and *MEG8* are amongst the most upregulated lncRNAs in D492M ([Figure 1C](#F1){ref-type="fig"}). The non-coding part of the DLK1-DIO3 locus consists of maternally expressed lncRNAs *MEG3* and *MEG8* and miRNAs grouped into two clusters ([Figure 1D](#F1){ref-type="fig"}). To confirm the sequencing results, we selected four representative miRNAs from the DLK1-DIO3 locus, two from each cluster (MIR127 and MIR493 from cluster A, MIR409 and MIR411 from cluster B). These miRNAs as well as the lncRNA *MEG3* had higher expression, as revealed by qRT-PCR, in D492M compared to D492 ([Figure 1E](#F1){ref-type="fig"}). In another isogenic EMT cell model, HMLE (epithelial) and HMLEmes (mesenchymal variant) both *MEG3* and the representative miRNAs were more highly expressed in HMLEmes compared to HMLE ([Figure 1F](#F1){ref-type="fig"}). Thus, our data suggests that increased *MEG3* expression is not a stochastic event but consistently associates with EMT induction in breast epithelial cell lines.
Next, we analyzed the expression of *MEG3* and miRNAs from the DLK1-DIO3 locus in primary cells from three healthy donors. We found that the expression of *MEG3* is higher in purified stromal cells (fibroblasts) than in epithelial cells (D492, luminal epithelial cells, myoepithelial cells and organoids; [Figure 2](#F2){ref-type="fig"}, left). Interestingly, expression of *MEG3* in whole breast tissue lysates is closer to fibroblast expression levels than epithelial cells ([Figure 2](#F2){ref-type="fig"}, left). This finding is most likely explained by the richness of stroma in normal breast tissue, whereas organoids contain only the epithelial cells. A similar pattern is seen with the four representative miRNAs, where MIR127 and MIR411 have higher expression in fibroblasts compared to their expression in D492 ([Figure 2](#F2){ref-type="fig"}, right).
We next acquired a list of genes correlated the expression of MEG3 using the GOBO (Gene expression-based Outcome for Breast Cancer Online) dataset and submitted the list to DAVID (the database for annotation, visualization and integrated discovery, version 6.7) ([@B47], [@B48]) to identify pathways associated with *MEG3*. Herein, the expression of *MEG3* correlates with expression of extracellular matrix genes, which are in line with the observations of a high expression of *MEG3* in cells found in the stromal compartment ([Supplementary Figure 2A](#SM1){ref-type="supplementary-material"}). Using analysis of publicly available NGS data using MiPanda ([@B75]) we found positive correlation of *MEG3* with common EMT markers in normal breast and breast cancer ([Supplementary Figure 2B](#SM1){ref-type="supplementary-material"}). Many of these have a correlation coefficient \> 0.3 (Spearman correlation) which is considered a fair positive correlation ([@B15]). Interestingly, even more genes are positively correlated to *MEG3* expression in breast cancer as compared to normal breast tissue ([Supplementary Figure 2B](#SM1){ref-type="supplementary-material"}).
Collectively, the lncRNA *MEG3* and miRNAs from DLK1-DIO3 locus are highly expressed in the mesenchymal compartment compared to epithelial breast tissue and their expression positively correlate with numerous mesenchymal genes and EMT markers.
MEG3 Is Imprinted in Both D492 and D492M {#S3.SS2}
----------------------------------------
The DLK1-DIO3 locus is imprinted and regulated by DNA methylation ([@B20]). Using pyrosequencing ([@B43]) covering a heterozygous SNP (C/T) in *MEG3* (rs4906024) we confirmed monoallelic expression of *MEG3* in both D492 and D492M, with expression in both cell lines being from the T allele ([Figure 3](#F3){ref-type="fig"}). As both cell lines are diploid at the *MEG3* locus on a DNA level a C/T ratio of 50% is expected which is consistent with the 48% C-allele prominence observed. On the mRNA deviation from expected monoallelic expression was not detected as results showed zero C allele expression in D492 and 2% in D492M. Hence, increased expression of *MEG3* in D492M is not caused by loss of imprinting. The expression remains monoallelic confirming that the increased expression originates from the non-imprinted allele.
{#F3}
{#F4}
{#F5}
Increased Expression of *MEG3* Is Negatively Correlated With Survival of Breast Cancer Patients {#S3.SS3}
-----------------------------------------------------------------------------------------------
EMT has been suggested to promote metastatic behavior of epithelia-originating cancer ([@B31]) and, in addition, our data shows association of *MEG3* expression with the mesenchymal phenotype. We therefore investigated *MEG3* expression levels in different subtypes of breast cancer. We have evaluated the expression of *MEG3* in clinically well-defined breast tumors. Herein, normal like (NL) breast tumors had significantly higher expression of *MEG3* with a *p*-value of 0.0003 ([Figure 4A](#F4){ref-type="fig"}, left). Survival analysis of all tumor samples showed reduced, but not significant overall survival in patients with high *MEG3* expression. However, as the normal-like tumors have in recent years been subjected to scrutiny as a possible misclassification due to low tumor cellularity and thus, high proportion of normal tissue. In light of our results showing high expression of *MEG3* in breast stromal tissue, and uncertainty that measured *MEG3* expression in the normal-like subgroup is representative of the primary tumor, we omitted NL breast tumors from the survival analysis ([@B29]; [@B80]; [@B109]). The results show significant worse overall survival of patients with high *MEG3* expression ([Figure 4A](#F4){ref-type="fig"}, right). Corroborating our findings, using the GOBO database ([@B84])^[1](#footnote1){ref-type="fn"}^, we found that high *MEG3* expression reduces distant metastasis free survival (DMSF) of patients with poorly differentiated (grade 3) tumors ([Figure 4A](#F4){ref-type="fig"}, left) and patients with luminal B tumors ([Figure 4B](#F4){ref-type="fig"}, right).
Increased Expression at the DLK1-DIO3 Locus Contributes to the Basal and Mesenchymal Phenotype {#S3.SS4}
----------------------------------------------------------------------------------------------
To explore the functional role of *MEG3* in D492 and D492M, we established sublines with altered expression of *MEG3*. Using the CRISPRa approach ([@B16]), we generated a D492 cell line with stable overexpression of *MEG3* (D492^MEG3^). A control cell line was generated using a scrambled sgRNA (D492^CTRL^). Furthermore, we used the CRISPRi approach ([@B37]; [@B81]), to generate knockdown of *MEG3* in D492M (D492M^KD--MEG3^) and a control cell line was generated using scrambled sgRNA (D492M^KD--CTRL^). The increase of *MEG3* expression was about seven-fold in D492^MEG3^ compared to D492^CTRL^ as determined by qRT-PCR ([Figure 5A](#F5){ref-type="fig"}, left). Downregulation of *MEG3* in D492M^KD--MEG3^ was more prominent, with about 20-fold reduced expression compared to D492M^KD--CTRL^ ([Figure 5A](#F5){ref-type="fig"}, right). Having established stable overexpression and downregulation of *MEG3* in D492 and D492M, we re-evaluated the epithelial/mesenchymal phenotypes of D492 and D492M, respectively. Based on phase contrast images, no obvious difference in phenotype could be seen between D492^MEG3^ and D492^CTRL^ or D492M^KD--MEG3^ and D492M^KD--CTRL^ ([Figure 5A](#F5){ref-type="fig"}, below). Interestingly, expression of the representative miRNAs located on the DLK1-DIO3 locus is increased in D492^MEG3^ compared to D492^CTRL^, to similar levels as seen in D492M ([Figure 5B](#F5){ref-type="fig"}, left). Conversely, the expression of representative miRNAs is downregulated in D492M^KD--MEG3^ compared to D492M^KD--CTRL^ ([Figure 5B](#F5){ref-type="fig"}, right). Thus, it appears, that the expression of miRNAs from the DLK1-DIO3 locus is concomitant with *MEG3* expression. To test, if that holds true, we used the cBioPortal and explored correlation of *MEG3* with miRNAs using data on invasive breast cancer from the Cancer Genome Atlas (TCGA) ([@B12]) we found that of 40 miRNAs that had positive correlation over 0,3 (Person score) with *MEG3*, 30 were located at the DLK1-DIO3 locus (with other miRNAs from the locus not being in the dataset; [Table 1](#T1){ref-type="table"}). This suggests that *MEG3* may be used as a marker for the expression of ncRNAs from the DLK1-DIO3 locus.
######
MiRNAs from the DLK1-DIO3 locus positively correlate with *MEG3* expression.
------------------------------
------------------------------
Out of 40 miRNAs that positively correlate with
MEG3
in breast cancer (with correlation over 0.3), 30 are from the DLK1-DIO3 locus, highlighted in orange (TCGA, Nature 2012 data set).
\#
Due to sequence similarities, these two miRNAs are indistinguishable in the sequencing data used.
Next, we conducted RNA sequencing of our cell lines with stably altered expression levels of *MEG3* focusing on the analysis of D492M^KD--CTRL^ vs D492M^KD--MEG3^. There were 1235 significantly differentially expressed genes, with symmetric distribution over genes downregulated and upregulated in D492M^KD--MEG3^, shown in the volcano plot (*p* \< 0.05; [Supplementary Figure 3A](#SM1){ref-type="supplementary-material"}), with the list of top 30 up and down-regulated genes in D492M^KD--MEG3^ ([Supplementary Figure 3B](#SM1){ref-type="supplementary-material"}). To identify unifying biological them from RNA-sequencing data, we performed Gene Set enrichment analysis (GSEA). These gene sets consist of the defined gene lists, based on biological knowledge about biochemical pathways and co-expression data. Using the Hallmark dataset, one of the significantly, downregulated set of genes in D492M^KD--MEG3^ was the epithelial-mesenchymal transition gene set, with normalized enrichment score (NES) of −2.03 and False discovery rate (FDR) *q* = 0.023 ([Figure 6A](#F6){ref-type="fig"}). These genes define epithelial-mesenchymal transition, as in wound healing, fibrosis and metastasis. The genes belonging to this gene set are overrepresented toward the top of the ranked list, based on fold change of D492M^KD--CTRL^ vs D492M^KD--MEG3^ ([Figure 6B](#F6){ref-type="fig"}, right). A manually curated list of mesenchymal genes from the Hallmark EMT dataset that are downregulated in D492M^KD--MEG3^ is shown in [Figure 6B](#F6){ref-type="fig"}, left. Further analysis of the RNA sequencing data of D492M^KD--MEG3^ vs D492M^KD--CTRL^, using common literature-based markers of breast tissue has showed that luminal epithelial markers *GATA3* and *MUC1* are upregulated, while myoepithelial *KRT14*, mesenchymal *VIM*, *ZEB2*, *SNAI2*, *LAMA1*, *CDH2*, and stem cell *MME*, *CTNNB1* are downregulated with knock down of *MEG3* ([Figure 6C](#F6){ref-type="fig"}).
{#F6}
{#F7}
{#F8}
Expression of mesenchymal and basal markers was additionally confirmed on RNA level by qRT-PCR and on protein level western blot. Most of the core EMT-related transcription factors (EMT-TF) were affected by *MEG3*. D492^MEG3^ has increased expression of *SNAI2* compared to D492^CTRL^ ([Figure 7A](#F7){ref-type="fig"}, left). On the other hand, D492M^KD--MEG3^ has decreased expression of *SNAI2*, *ZEB1*, *ZEB2* and *TWIST1* compared to D492M^KD--CTRL^ ([Figure 7A](#F7){ref-type="fig"}, right). Luminal cytokeratin 19 (*KRT19*) and basal/myoepithelial cytokeratin 14 (*KRT14*) are also affected by manipulation of *MEG3* expression levels. Thus, D492^MEG3^ shows increased *KRT14* and decreased *KRT19* expression compared to D492^CTRL^ on both mRNA ([Figure 7B](#F7){ref-type="fig"}, left) and protein level ([Figure 7C](#F7){ref-type="fig"}, left). D492M^KD--MEG3^ shows decreased *KRT14* expression compared to D492M^KD--CTRL^ ([Figure 7B](#F7){ref-type="fig"}, right). Furthermore, D492^MEG3^ shows increased expression of other myoepithelial markers such as *CDH3* (P-cad), *TP63* or *KRT5* compared to D492^CTRL^ as determined both at mRNA ([Figure 7D](#F7){ref-type="fig"}, left) and protein level ([Figure 7E](#F7){ref-type="fig"}). Also, D492M^KD--MEG3^ shows decreased expression of myoepithelial markers *KRT5* on mRNA level ([Figure 7D](#F7){ref-type="fig"}, right) and of TP63 on protein level ([Figure 7E](#F7){ref-type="fig"}, middle) compared to D492M^KD--CTRL^. This suggests that *MEG3* expression induces a shift toward a basal/myoepithelial phenotype. However, our cell lines with stably altered expression of *MEG3* do not show a significant switch in E-cadherin (CDH1) to N-cadherin (CDH2) expression ([Supplementary Figure 4](#SM1){ref-type="supplementary-material"}), which may explain why there are no clear changes in morphology.
*MEG3* Induces Mesenchymal Properties and Stemness {#S3.SS5}
--------------------------------------------------
As *MEG3* has previously been ascribed to have a role in pluripotency and stemness ([@B93]; [@B52]), we asked how *MEG3* manipulation affects mesenchymal and stem cell properties of D492 and D492M. The expression of both aldehyde dehydrogenase (*ALDH1A3*) and integrin alpha 6 (*ITGA6*; [Supplementary Figure 6](#SM1){ref-type="supplementary-material"}), markers of stemness, is increased in D492^MEG3^ compared to D492^CTRL^. Next, we employed several functional assays to assess the effect of *MEG3* levels in D492 and D492M on mesenchymal and stem cell properties. D492^MEG3^ is more resistant to chemically induced apoptosis than D492^CTRL^ ([Figure 8A](#F8){ref-type="fig"}). Migration can be assessed *in vitro* using the wound healing assay or by trans-well migration where the cells migrate toward a chemo-attractant. In the wound healing assay, D492^MEG3^ has slightly increased migration rate compared to D492^CTRL^, while D492M^KD--MEG3^ has decreased migration rate compared to D492M^KD--CTRL^ ([Supplementary Figure 5A](#SM1){ref-type="supplementary-material"}). In the trans-well migration assay, D492^MEG3^ has about two-fold increased migration rate compared to D492^CTRL^ and D492M^KD--MEG3^ has reduced migration rate compared to D492M^KD--CTRL^ ([Figure 8B](#F8){ref-type="fig"}). *MEG3* manipulation, however, did not affect invasion in a transwell invasion assay ([Supplementary Figure 5B](#SM1){ref-type="supplementary-material"}). We performed mammosphere assays in rBM (reconstituted basement membrane, Matrigel) ([Figure 8C](#F8){ref-type="fig"}) and in low attachment plates ([Figure 8D](#F8){ref-type="fig"}), with comparable results. D492^MEG3^ increases the formation of colonies compared to D492^CTRL^ while D492M^KD--MEG3^ decreases the formation of colonies compared to D492M^KD--CTRL^. In addition, we co-cultured D492^MEG3^ with endothelial cells (HUVECs) and observed increased size of colonies and less branching compared to D492^CTRL^ ([Figure 8E](#F8){ref-type="fig"}). Finally, manipulation of *MEG3* levels slightly affected proliferation rate of D492M^KD--MEG3^ compared to D492M^KD--CTRL^ ([Supplementary Figure 5C](#SM1){ref-type="supplementary-material"}).
Discussion {#S4}
==========
In this study, we show that ncRNAs from the DLK1-DIO3 locus are highly expressed in stromal/mesenchymal cells in the breast and positively correlate with the expression of EMT genes in breast tissue. *MEG3* expression was monoallelic in both D492 and D492M and gain and loss of function studies have shown concomitant expression of *MEG3* with miRNAs from the DLK1-DIO3 locus, indicating that *MEG3* could be used as a marker for the expression of the non-coding RNAs from the locus. *MEG3* expression was shown to be negatively correlated with survival of breast cancer patients, particularly with the luminal B subtype. Furthermore, we demonstrate that enhanced *MEG3* expression accompanied by increased expression of the ncRNAs at the DLK1-DIO3 locus, contributes to partial EMT more correctly referred to as epithelial plasticity, seen by increased expression of EMT related TFs, increase of basal/mesenchymal markers and enhanced properties such as migration, resistance to apoptosis and clonogenic capacity.
We used an isogenic breast cell line model to study the expression pattern and functional role of ncRNAs, both miRNAs and lncRNAs, in EMT. Of interest was the largest miRNA locus in the human genome and the lncRNA *MEG3*, both within the DLK1-DIO3 imprinted region on chromosome 14. The non-coding part of the DLK1-DIO3 locus has higher expression in cells with mesenchymal phenotype (D492M) compared to cells with epithelial phenotype (D492). These results were validated in primary breast tissue and in another cellular model of EMT. Furthermore, we have shown that *MEG3* expression correlates with expression of extracellular matrix proteins, which are secreted by cells with a mesenchymal phenotype, and with mesenchymal genes in breast tissue. Data from pyrosequencing demonstrate that the expression of *MEG3* is monoallelic in both D492 and D492M indicating that the increased expression of *MEG3* in D492M is not due to loss of imprinting. We have shown that *MEG3* negatively correlates with survival of luminal B breast cancer patients and patients with grade 3 breast cancer. This is in line with a recent study where high expression of *MEG3* was identified to be a negative prognostic marker for breast cancer ([@B108]).
Many studies suggest *MEG3* as a tumor suppressor, largely due to the observation that *MEG3* expression is lower in tumor tissue compared to normal tissue ([@B89]; [@B96], [@B94]; [@B110]; [@B14]; [@B68]). Our data demonstrates that *MEG3* expression levels are comparable in whole normal breast tissue and in stroma (fibroblasts), however, the expression of *MEG3* in epithelial cells is much lower. There was considerable variation of the *MEG3* expression in breast tissue samples that could be partially due to different proportions of subset of fibroblasts associated with ducts vs TDLUs. There are studies confirming existence of, for instance, two distinct functionally specialized lineages of lobular vs ductal fibroblast ([@B71]) or myoepithelial cells ([@B32]), which could be identified by specific marker expression. Importantly, relative proportions of stromal and epithelial compartment are different in normal and cancerous human breast tissue. Breast cancers arise in vast majority from epithelial cells, with TDLUs being the predominant site of breast tumor occurrence ([@B97]). Therefore, it would be expected that expression of *MEG3* is higher in normal breast tissue, as it comprises relatively more stromal cells compared to breast cancer tissue. In line with this, expression of *MEG3* from whole breast tissue is distorted as proportions of stroma vs epithelia in normal/cancer tissue are different, resulting in misleading interpretations. Using RNA only from unsorted normal tissue will mainly represents expression of stromal cells. Therefore, it is crucial to use a proper control when comparing expression of genes in normal vs tumor tissue. Single-cell RNA-sequencing or sorted stromal and epithelial cells would give more informative results as it would enable distinctions between epithelial and stromal tissue compartments. In this paper we show that *MEG3* expression negatively correlates with survival in breast cancer, particularly in grade three tumors and the luminal B subtype. However, our study does not determine if the high *MEG3* expression represents increased stromal infiltration in the tumors or elevated expression in cancer cells.
Another reason for classifying *MEG3* as tumor suppressor is its action on stabilization of p53 ([@B35]). However, inactivation of p53 is a frequent event in cancer, estimated to have about 50 % occurrence ([@B34]; [@B64]; [@B44]). The percentage is even higher, when the inactivation in p53's regulatory pathways is considered ([@B51]). Therefore, the use of cell lines which lack active p53, such as D492 and D492M, offers a different approach, more relevant for studying breast cancer signaling pathways, to study the role of DLK1-DIO3. The role of p53 in the cell is that of a tumor suppressor, impacting acts in proliferation, cell cycle and genomic stability ([@B66]). In D492 cell lines, as could be expected, we did not observe effect on cell proliferation. Recently, Uroda and colleagues' stated, that cell cycle arrest by *MEG3* is exclusively p53-dependent, ([@B102]), in line with our suggestions that *MEG3* can have a different role in cells lacking p53. Collectively, these observations could explain the conflicting results about role of *MEG3* in tumors.
Many imprinted genes are located in clusters regulated by a differentially methylated regions (DMRs) ([@B6]). In our study targeting the *MEG3* promoter, we have observed concomitant expression of *MEG3* with other miRNAs from the DLK1-DIO3 locus. Our data may support previous studies showing that the *MEG3* promoter controls expression of all maternally expressed genes from the DLK1-DIO3 locus ([@B101]; [@B50]; [@B86]). [@B116] have shown that the MEG3-DMR overlaps with the *MEG3* gene promoter and any deletion in this region inactivates both MEG3-DMR and the *MEG3* gene. Their data shows, that it is the MEG3-DMR, not the *MEG3* gene, which regulates imprinting (and expression). Therefore, by targeting the *MEG3* promoter at the MEG3-DMR all the non-coding RNAs at the DLK1-DIO3 locus are inactivated. *MEG3* expression can be considered as a marker for the expression of other ncRNAs at the locus.
Cellular plasticity, an important contributor to heterogeneity and drug resistance in breast cancer can be conveyed through EMT/MET ([@B59]). Partial EMT (p-EMT) may reflect cellular plasticity better than full-EMT and consequently, cells possessing this state adapt more easily to a new environment, which is necessary for cancer cell invasion and metastasis ([@B100]; [@B98]; [@B54]). Notably, a recent report highlights the importance of the intermediate stages of EMT for the intravasation of tumor cells and for metastasis formation in experimental breast or skin tumors ([@B76]). Similarly, another study showed that cancer cells might only reach an intermediate EMT stage allowing for increased motility, while keeping its cellular plasticity ([@B9]). It has also been observed that full mesenchymal phenotype (EMT), has a low capacity to form metastasis compared to p-EMT ([@B88]). The essential criteria for aggressive behavior does not need to be a particular phenotype, but rather enhanced cellular plasticity, as is also observed for hybrid E/M cells ([@B38]). Thus, EMT may be viewed as a trans-differentiation process where epithelial and mesenchymal cells interconvert by passing through an intermediate "stem-like" state ([@B39]).
EMT is a complex process and meta-analysis indicates that there are possibly different types of EMT ([@B56]). We have shown, that by manipulating *MEG3* expression, and thus changing the expression of the non-coding genes at the DLK1-DIO3 locus, the majority of these EMT related TFs are affected, indicating an important role of the ncRNAs the DLK1-DIO3 locus in the EMT process. One of the most typical hallmarks of EMT is downregulation of *CDH1* (E-cadherin) and epithelial-specific keratins ([@B78]). Altered expression of *MEG3* does not lead to change of E-cadherin expression and therefore *MEG3* may have induced only a partial EMT phenotype. However, it has been shown, that cells with p-EMT phenotype display concomitant expression of epithelial and mesenchymal markers ([@B4]) and loss of E-cadherin is not a prerequisite for EMT ([@B46]). Cells undergoing collective migration have hybrid EMT phenotype characterized by E-cadherin expression, which helps to maintain cell--cell contacts ([@B33]; [@B1]). Furthermore, we have shown that altered expression of *MEG3* revealed distinct luminal and myoepithelial marker expression. Increased expression of *KRT14* and decreased expression *KRT19* indicate increased myoepithelial differentiation, which has been connected to a partial EMT phenotype ([@B79]). Study on collective migration revealed *KRT14* as a key regulator of metastasis ([@B18]) and the same applied for collective invasion, which was facilitated by subpopulation of cells expressing *KRT14* ([@B17]). The observed increase of myoepithelial/basal differentiation in cells with higher expression of *MEG3* was supported with altered expression of other markers such as *KRT5*, *TP63*, and *CDH3*.
A key characteristic defining breast stem cells is the ability to form of mammospheres ([@B26]; [@B38]). Morel and colleagues confirmed that human mammary epithelial cells undergoing EMT exhibited better mammosphere-forming capabilities ([@B70]) and Shimono et al. have shown that mammosphere-forming activity is abrogated in both normal and malignant mammary stem cells when the EMT program is shut down ([@B90]). In this study phenotypic differences upon altered MEG3 expression were more prominent in 3D than in 2D cell culture, where *MEG3* increased mammosphere formation ability and slightly decreases branching potential in 3D culture. Furthermore, we have shown increased expression of *ALDH1A3* and *ITGA6*, in cells with overexpression of *MEG3*, supporting role of *MEG3* in stemness.
We propose that increased expression of *MEG3*, and thus increased expression of the ncRNAs at the DLK1-DIO3 locus, in D492 leads to partial EMT phenotype/enhanced plasticity, seen by molecular changes with increased mesenchymal and myoepithelial/basal genes and increased migration and resistance to apoptosis. In contrast, the repression of *MEG3*, and the maternally imprinted ncRNAs, in D492M leads to decreased mesenchymal and basal gene expression and decreased migration and resistance to apoptosis. Nguyen-Ngoc et al. also demonstrated, that motility can occur in cells that retain an epithelial molecular signature ([@B73]). This supports our observation, that manipulation of *MEG3* expression did not affect the morphological phenotype, but rather affected the functional phenotype. These characteristic properties of cells undergoing EMT were originally proposed to occur in breast cancer by Mani and colleagues ([@B63]), showing that stem-like and p-EMT properties share many characteristics, such as increased migration, resistance and survival ([@B19]; [@B4]; [@B42]).
Increased understanding of branching morphogenesis in the breast and the regulation of EMT and MET may hold the key for future development of methods and drugs that neutralize the invading properties of cancer cells. Currently, there is need for biomarkers to accurately monitor the EMT/MET process that may improve treatment. Prognostic value of *MEG3* in human malignancies remains controversial and requires further investigation. Our results and conflicting data from the literature suggest that *MEG3* has a complex role in breast tissue.
Data Availability Statement {#S5}
===========================
The RNAseq data for this article has been submitted to GEO, with the GEO accession number [GSE142268](GSE142268), see here: <https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE142268>
Ethics Statement {#S6}
================
The studies involving human participants were reviewed and approved by Icelandic National Bioethics Committee VSN-13-057 and VSN-11-105-V2. The Icelandic Data Protection Commission (2001/523 and 2002/463) Landspitali Ethical Committee No. 35/2013. The patients/participants provided their written informed consent to participate in this study.
Author Contributions {#S7}
====================
MM, TG, JB, ZB, EB, GT, and BH: conceptualization and design of the study. ZB, EB, JB, AS, and BH: data acquisition. ZB, AS, EB, GT, SS, and BH: data analysis. ZB, GT, TG, and BH: drafting the manuscript. All authors participated in data interpretation, revision of the manuscript and approved the final version to be published.
Conflict of Interest {#conf1}
====================
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
**Funding** This work was supported by Grants from Landspitali University Hospital Science Fund, University of Iceland Research Fund, Icelandic Science and Technology Policy Council Research Fund no. 1103010061, Icelandic Science and Technology Policy -- Grant of Excellence: 52144051, "Vísindasjóður Krabbameinsfélagsins" (Icelandic Cancer Society Science Fund) 2017 and 'Göngum saman', a supporting group for breast cancer research in Iceland (www.gongumsaman.is). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
The authors would like to thank Rosa B. Barkardottir, Adalgeir Arason, Bjarni A. Agnarsson, and Oskar Thor Johannsson for their contribution to this work by providing RNA samples from breast cancer patients and pathological and clinical information. We would also like to thank Gudrun Johannesdottir for excellent technical support.
<http://co.bmc.lu.se/gobo/>
Supplementary Material {#S10}
======================
The Supplementary Material for this article can be found online at: <https://www.frontiersin.org/articles/10.3389/fcell.2020.00461/full#supplementary-material>
######
Click here for additional data file.
[^1]: Edited by: Zuzana Koledova, Masaryk University, Czechia
[^2]: Reviewed by: Lone Rønnov-Jessen, University of Copenhagen, Denmark; Giulia Ricci, University of Campania Luigi Vanvitelli, Italy; Zhongxin Lu, Huazhong University of Science and Technology, China
[^3]: This article was submitted to Stem Cell Research, a section of the journal Frontiers in Cell and Developmental Biology
| {
"pile_set_name": "PubMed Central"
} |
Diagnostic Performance of Retinopathy in the Detection of Diabetic Nephropathy in Type 2 Diabetes: A Systematic Review and Meta-Analysis of 45 Studies.
To conduct an evidence-based evaluation of diabetic retinopathy (DR) for the diagnosis of diabetic nephropathy (DN) in type 2 diabetics with kidney disease. We systematically searched PubMed, EMBASE, and the Cochrane Library from inception to June 27, 2018, including the reference lists of identified primary studies. A study was included if it (1) used DR as a diagnostic test for DN; and (2) used histological evaluation of renal tissues as the reference standard. The analysis included 45 studies (4,561 patients). A bivariate analysis yielded a sensitivity of 0.67 (95% CI 0.61-0.74) and a specificity of 0.78 (95% CI 0.73-0.82). The summary receiver operating characteristic curve analysis provided an area under the curve (AUC) of 0.79 (95% CI 0.76-0.83). In a setting of 41% prevalence of DN, the probability of DN would be 68% if the test of DR was positive, and the probability of DN would be 23% if it was negative. In addition, although the mean specificity of proliferative DR for the detection of DN was 0.99 (95% CI 0.45-1.00), the mean sensitivity was 0.34 (95% CI 0.24-0.44), and the AUC was 0.58 (95% CI 0.53-0.62). DR is helpful in diagnosing DN in persons with type 2 diabetes and kidney disease, but the severity of DR may not parallel the presence of DN. | {
"pile_set_name": "PubMed Abstracts"
} |
32 So.3d 60 (2010)
THE FLORIDA BAR
v.
MARTIN (PETER).
No. SC09-1307.
Supreme Court of Florida.
March 8, 2010.
Decision Without Published Opinion Reinstated.
| {
"pile_set_name": "FreeLaw"
} |
Influence of the breathing mode on the time course and amplitude of the cyclic inter-atrial pressure reversal in postoperative coronary bypass surgery patients.
The haemodynamic basis for paradoxical embolization in patients with stroke and decompression sickness has not yet been fully elucidated. Therefore right and left atrial pressures were measured simultaneously with peroperatively placed catheters after coronary artery bypass grafting in 17 patients with sinus rhythm and normal left ventricular function. Recordings were made both during spontaneous breathing and positive pressure ventilation. A cyclic pressure reversal in which right atrial pressure exceeded left atrial pressure was reproducibly recorded. It started on average 215 +/- 5 ms (mean +/- SEM) after the onset of the electrocardiographic P-wave, lasted on average 179 +/- 14 ms and had a maximal amplitude of on average 4.1 +/- 0.3 mmHg. During the expiration phase of spontaneous breathing and inspiration phase of positive pressure ventilation, the onset of the pressure reversal occurred later, its duration was shorter and its amplitude smaller. These observations demonstrate the presence of a cyclic inter-atrial pressure reversal and illustrate the importance of the breathing mode for the time course and amplitude of this reversal. | {
"pile_set_name": "PubMed Abstracts"
} |
Ireland can be justly proud of the history and quality of its medical education. Graduates of Irish medical schools are accepted globally as being of international standard and many of the most eminent of Irish medical professionals have returned to Ireland after periods of distinguished service in...
Ireland’s higher education system has played a major role in the development of Irish society and the economy, and has an even more critical role to play in the coming decades as we seek to rebuild an innovative knowledge-based economy that will provide sustainable employment opportunities...
Ireland’s higher education system has played a major role in the development of Irish society and the economy, and has an even more critical role to play in the coming decades as we seek to rebuild an innovative knowledge-based economy that will provide sustainable employment opportunities...
The purpose of this plan is to set out in detail the necessary actions to implement the recommendations as described in National Strategy for Higher education in Ireland to 2030; to show where lead responsibility will lie amongst the various actors involved in the higher education sector and to...
The National Strategy for Higher Education was launched in January 2011. In order to ensure effective oversight of implementation of the strategy the Department of Education and Skills has established an Implementation Oversight Group. The Oversight Group is co-ordinating, monitoring and reporting...
The National Strategy for Higher Education was launched in January 2011. In order to ensure effective oversight of implementation of the strategy the Department of Education and Skills has established an Implementation Oversight Group. The Oversight Group is co-ordinating, monitoring and reporting...
The National Strategy for Higher Education was launched in January 2011. In order to ensure effective oversight of implementation of the strategy the Department of Education and Skills has established an Implementation Oversight Group. The Oversight Group is co-ordinating, monitoring and reporting...
The Government’s Framework for Sustainable Economic Renewal- Building Ireland’s Smart Economy, launched by the Taoiseach in late 2008, establishes Ireland’s ambition to become internationally renowned as an Innovation Island. At the core of achieving this ambition will be our...
Investing in Global Relationships: Ireland’s International Education Strategy 2010 – 2015 was published in September 2010. Significant progress has been made in implementing this strategy, to complement and support the work undertaken at institutional level:
- A strong national brand... | {
"pile_set_name": "Pile-CC"
} |
2009 Mediterranean wildfires
The 2009 Mediterranean wildfires were a series of wildfires that broke out across France, Greece, Italy, Spain, and Turkey in July 2009. Strong winds spread the fire during a hot, dry period of weather killing at least eight people, six of whom were in Spain. Some of the wildfires were caused by lightning, along with arson and military training.
Effects
Four Spanish firefighters died in Catalonia on 21 July, and a fifth member died later from injuries on 23 July, as well as a fire engine driver in Teruel. A further two people died from bush fires in Sardinia. More than 120 people were rescued at Capo Pecora on Sardinia by helicopter and civil protection boats. The Arenas prison complex was evacuated and the inmates were temporarily transferred to the beach.
Northern and central Spain saw temperatures of around on 21 July. Around 2,000 people were evacuated from hills around the town of Collado Mediano, near Madrid. Aircraft with water and firefighters controlled the fire.
Estimates suggest that 5,000 hectares of forest and bush were affected in the Sierra Cabrera mountain range between Turre and Mojácar in Spain on 14–15 July. 500 people were evacuated, as dozens of firefighters and soldiers controlled the fires, including the use of five helicopters and three aircraft. On 23 July, the fires on the Sierra Cabrera on which Mojácar sits flared again, causing damage to the village and other houses in the area and the evacuation of around 1,500 residents.
Outside the French city of Marseille, 1,300 hectares (3211 acres) were destroyed. In Corsica, wildfires led to the destruction of approximately 4,000 hectares (10,000 acres) of bush and forest resulting in the injuries of five firemen.
More than 320 wildfires affected patches of forest across Greece, although they did affect buildings. Most of them were located on the island of Euboea and the southern Peloponnese.
On 23 July, over 15 hectares of land were destroyed in a landfill site in Bodrum, southwestern Turkey. Over 200 volunteers and 100 firefighters tried to contain the fires across Turkey, which saw temperatures of on 25–26 July.
Causes
In the Mediterranean region, the current fire frequency due to human activity is considered much larger than the natural rate. 95% of forest fires in Spain are human-induced. The 2009 Mediterranean wildfires occurred during a particularly hot and dry summer period, increasing the risk of wildfires burning out of control once ignited. Temperatures peaked at in mainland Spain and reached in Gran Canaria. These conditions, combined with insufficient fire-fighting resources and an inadequate official response in some of the affected countries, exacerbated the extent of the damage.
Uncontrolled legal and illegal scrub burning by farmers is a major cause of forest fires in the Mediterranean region. Arson, while still a significant factor, has diminished in Spain and Greece in recent years. Decreasing property values generally and the introduction of legislation in Spain to tackle the issue has diminished the financial incentive to illegally clear forested land for development by burning. Isolated cases of areas in Spain affected by fires caused by lightning strikes include Aragon (Spain), as reported by El Pais and Mojácar, as suggested by the Spanish Forest Fire Organisation (INFOCA). The wildfires outside of Marseille, France were reported as being caused by military training using tracer bullets. The local government of Corsica believed the fires were caused by arson.
References
See also
2009 Greek forest fires
Category:Wildfires caused by arson
Category:Arson in Europe
Category:Mass murder in 2009
Mediterranean Wildfires, 2009
Category:July 2009 events in Europe
Category:2009 in France
Category:2009 in Greece
Category:2009 in Italy
Category:2009 in Spain
Category:2009 in Turkey | {
"pile_set_name": "Wikipedia (en)"
} |
id: 1012
title: Review
summary:
content: |
Now, let's quickly review some learnings from this assignment.
| {
"pile_set_name": "Github"
} |
Lawmakers Derail Efforts to Combat Opioid Abuse
Bill would use national standards to help control prescription abuse and addiction in Workers’ Comp System
HARRISBURG (Feb. 12, 2018) – The National Federation of Independent Business (NFIB) expressed grave concern after the state House failed to pass HB 936, which creates a drug formulary within the PA workers’ compensation system. The measure would set guidelines for treatments and prescriptions based on widely accepted medical standards. The bill would address painkiller over-prescribing, fraud in the system, and control costs.
“Given the Legislature’s interest in combating opioid abuse and addiction, it is inconceivable to me that lawmakers would vote against nationally-accepted standards for dispensing drugs to injured workers. But that is exactly what happened,” said Kevin Shivers executive state director for NFIB PA. “PA’s workers’ comp system prescribes more opioids to injured workers than virtually all other states. Formularies are widely accepted and already exist in CHIP and Medicare programs with good reason. They protect a patient’s health and safety.”
HB 936 passed the state Senate 34 to 16. Tuesday, the bill failed after the House deadlocked 98 to 98. The bill is to be reconsidered in March. NFIB urged lawmakers who voted against the bill to seriously reconsider.
“Not only does this bill address opioid overprescribing,” added Shivers, “but it routs out fraud by legal and medical professionals who abuse the system. There have been reports exposing those who use injured workers as pawns in their greedy schemes, prescribing questionable medications and charging exorbitant prices.
“It is also important to note that the bill requires that any savings must be returned to businesses in the form of lower premiums, and not given back to insurers. That helps small businesses burdened with high insurance costs.” | {
"pile_set_name": "Pile-CC"
} |
London — When London last hosted the Olympics in 1948, the Games lacked nearly all the trappings of the mega-event they have since become.
Organizers reused existing venues, such as an old velodrome that had housed aerial defense balloons during the war. It lacked lighting, however, so officials turned on car headlights to see the finish of evening bike races.
Boxing and swimming took place in the same Wembley arena. The swimmers competed during the first week, then a boxing ring was built atop the pool, with no time to drain it.
As London hosts a big-budget modern Games this summer, nostalgia can be heard here for the simpler spirit of '48, one focused more on sport, and without the blown-out public budgets and corporations cashing in on stardom.
"These really were the people's Olympics. There was no element of corporate branding and sponsorship. People traveled around in buses," says Iain Sinclair, a noted east London author. "It's now become so grossly swollen and supporting such a mass of people who view themselves as entitled [to] VIP lanes."
Mr. Sinclair says the Olympics have turned into "an excuse for ripping up tranches of the [host] city and remaking it, and then half of it having to be abandoned later."
While London 2012 can be seen as a slight correction to the massive Beijing Games four years ago, the choice of London over Paris as host suggests the Olympic Committee still loves to see cities spend big and build more.
That said, there's a pattern in the run-up to most Games – even London '48 – of complaining about the spending and disruptions, he adds.
"There was a lot of grumbling that we just came out of a devastating war … and we're holding a big celebration three years later," he says. "The day the Olympics begin, all this will fall by the wayside."
The bare-bones '48 Games cost £750,000, or roughly £21.3 million in today's currency (about $33.1 million), and no public money was used. The Parliament's estimate of the price to the public of the 2012 Games hovers at £11 billion ($17 billion).
The organizers in 1948 economized out of necessity, given that most skilled labor was rebuilding other parts of London and materials were rationed. The Games' small profit was made mostly on ticket sales.
There was no Athletes' Village, nor special road lanes for VIPs. After winning gold in the 800 meters, American runner Mal Whitfield, still in his tracksuit, took the train back to team headquarters at nearby Uxbridge air base. He never mentioned his win to an elderly lady on the train who asked if he was an Olympic athlete.
Compared with Londoners today, Londoners back then enjoyed amazing access to athletes and events – but at the cost of very few people getting a chance to see the Games.
TV would change all that, and the '48 Games saw the first broadcasts. Over the decades, the broadcasters would inject big money and bigger ambitions into the Games.
"I consider TV coverage overwhelmingly a positive development," says Mr. Wallechinsky, "even though there were some negative things – corporate entities became so powerful. There's only so many people who can fit into the stadium; but when you can have billions around the world watch it, I think that's a good thing."
Most journalists got the news out via a 1948 version of Twitter. US reporters in the press box wrote out short cables, putting each in a can and sending it down a pipe to a waiting Boy Scout. The boy biked the message from the stadium to the media center, where it was relayed by telegraph to a London office, then transmitted via Morse code to the United States.
The BBC had planned to televise only an hour a day of the Games at first, but expanded it to six hours with live broadcasts. So popular were the live broadcasts from Wembley that they helped expand London television ownership from 30,000 to 80,000 sets within a year.
"The communications then and now is probably the biggest single difference," says Mr. Rogan. "That's what has created what we got now. We have to live with that; we can't unpick that."
The massive TV audience attracted not only corporations but terrorists. After athletes were taken hostage at the 1972 Munich Olympics, security hardened in ways that make the low budget and informality of 1948 unimaginable.
But despite all the hoopla around today's Games, Rogan argues people can still glimpse Olympic ideals in the athletes.
"These are values that are worth fighting for," says Rogan, "and that's the only reason the concept has survived." | {
"pile_set_name": "Pile-CC"
} |
<?xml version="1.0" encoding="utf-8"?>
<LinearLayout xmlns:android="http://schemas.android.com/apk/res/android"
android:layout_width="match_parent"
android:layout_height="wrap_content"
android:gravity="center"
android:orientation="vertical">
<TextView
android:layout_width="wrap_content"
android:layout_height="wrap_content"
android:padding="5dip"
android:text="选一张图，说一个故事~"
android:textColor="@android:color/white"
android:textSize="14sp" />
</LinearLayout> | {
"pile_set_name": "Github"
} |
With severe storms making their way through the Heartlland, make sure you're signed up for StormTeam alerts, e-mails and/or texts.
David Letterman announced he will retire next year.
A shocking new ad discourages distracted driving as part of National Distracted Driving Awareness Month.
Good evening,
Showers and thunderstorms have been moving across the same areas of southern Illinois most of the day. Because of this, we have see areas of localized flooding. This activity will leave the Heartland by 6 p.m. Stay with Heartland News and the StormTeam at 9 and 10 for the latest.
You can stay alert and sign up for StormTeam weather alerts via the StormTeam Weather App. You can also sign up for e-mail and text alerts. Click here for more information.
Some say the new ads are shocking. As National Driving Awareness Month gets underway, the National Traffic and Safety Administration is getting ready to kick off the new ads to discourage distracted driving. Christy Millweard residents in Sikeston and the Missouri State Highway Patrol about the ads. You can click here to see what they said.
Some fans of the St. Louis Rams are planning a weekend rally to help keep the city’s NFL team from leaving. The Keep the Rams rally is scheduled for Saturday afternoon in Laclede’s Landing and comes amid growing unease over the team’s future.
The Kentucky Emergency Management (KYEM) will activate the State Emergency Operations Center in Frankfort and a Regional Response Coordination Center in Hopkinsville, Kentucky for the August 21st solar eclipse.
The Kentucky Emergency Management (KYEM) will activate the State Emergency Operations Center in Frankfort and a Regional Response Coordination Center in Hopkinsville, Kentucky for the August 21st solar eclipse. | {
"pile_set_name": "Pile-CC"
} |
William Lake (Dean of Durham)
William Charles Lake (9 January 1817 – 8 December 1897) was Dean of Durham and Warden of its university from 1869 to 1894.
Life
He was the eldest son of Captain Charles Lake of the Scots fusilier guards. He was educated at Rugby under Dr. Arnold, where he became the lifelong friend of his school-fellow, Arthur Penrhyn Stanley, and
Balliol, where he was elected Fellow in 1838 and was President of the Oxford Union.
He was ordained in 1842, but remained at Oxford until 1858.
In that year he became Rector of Huntspill; and in 1860 Canon of Wells.
Meanwhile, Lake's linguistic abilities had led to his appointment by Lord Panmure as a member of the commission of 1856, to report on military education on the continent.
He had won the prize at Oxford in 1840, for his Latin essay on the Roman army as an obstacle to civil liberty.
He also served on the Newcastle commission of 1858 to inquire into popular education, and on the royal commission upon military education of 1868.
On 9 August 1869, Lake was nominated by Gladstone for the deanery of Durham.
In 1881, he was a member of the ecclesiastical court's commission.
His theological position was that of a moderate high churchman, and in 1880 he joined Dean Church and others in endeavouring to induce Gladstone and Archbishop Tait to bring forward legislation modifying the Public Worship Regulation Act.
During Lake's decanate, Durham Cathedral was restored.
He exercised an important influence over Durham University of which he was warden, and education in the north of England generally owed much to his efforts.
The foundation of the College of Science at Newcastle in 1871 was very largely his work.
He resigned the deanery, owing to failing health, in 1894, and went to live at Torquay. There he died suddenly on 8 December 1897.
Family
He married, in June 1881, Miss Katherine Gladstone, a niece of the premier, who survived him.
Works
Lake published nothing separately but a few sermons and a pamphlet, "The Inspiration of Scripture and Eternal Punishment, with a preface on the Oxford Declaration and on F. D. Maurice's Letter to the Bishop of London," 1864. But he contributed to the Life of his friend Tait some highly interesting recollections, and especially a valuable picture of the independent position he held at Oxford, and an account from intimate knowledge of his life as head of Rugby, bishop of London, and primate.
Lake also supplied to Mr. Wilfrid Ward's W. G. Ward and the Oxford Movement (1889) some reminiscences of Ward, who was for some time his mathematical tutor at Balliol and exercised some influence over his tone of thought.
References
Attribution
Henri Brémond, L' évolution du clergé Anglican, Paris, Bloud et Gay, 1906
Sources
Category:1817 births
Category:People educated at Rugby School
Category:Fellows of Balliol College, Oxford
Category:Presidents of the Oxford Union
Category:1895 deaths
Category:Deans of Durham
Category:Vice-Chancellors and Wardens of Durham University | {
"pile_set_name": "Wikipedia (en)"
} |
---
abstract: |
An exact inversion formula for the Lorentz integral transform (LIT) is provided together with the spectrum of the LIT kernel. The exponential increase of the inverse Fourier transform of the LIT kernel entering the inversion formula explains the ill-posed character of the LIT approach. Also the continuous spectrum of the LIT kernel, which approaches zero points necessarily to the same defect. A possible cure is discussed and numerically illustrated.
[*Keywords:*]{}
ill-posed integral transform, Lorentz integral transform, few-body systems
author:
- 'W. Glöckle'
- 'M. Schwamb'
title: |
\
[**On the ill-posed character of the Lorentz integral transform** ]{}
---
Introduction {#kap1}
============
Integral transformations $$\label{int1}
L(y) = \int_{-\infty}^{\infty} d x \kappa(y,x) R(x)$$ are widespread used in physics. According to Hadamard [@Had02], the problem of finding the unknown function $R$ for a given transform $L$ is called “well-posed”, if the following conditions are fulfilled:
- The function $R$ exists and is unique.
- The function $R$ depends continously on the input $L$.
Otherwise, the problem (\[int1\]) is called “ill-posed”. As example, let us consider the well-known Laplace transformation $$\begin{aligned}
\label{laplace1}
L(y) = \int_0^{\infty} dx e^{-xy} R(x)\end{aligned}$$ which is widely used in physics and engineering. It turns out to be ill-posed. For illustration, consider the test function $$\label{laplace2}
R(x) = \frac{\sin(\frac{x}{\epsilon})}{\frac{x}{\epsilon}}$$ and its Laplace transform $$\label{laplace3}
L(y) = \epsilon \arctan(\frac{1}{ \epsilon y}) \,\, .$$ For $\epsilon \rightarrow 0$, the maximum norm of $L$ goes to 0, whereas the maximum norm of $R$ is 1 for any $ \epsilon$.
In this paper we study integral transforms, where the kernel $ \kappa $ in (\[int1\]) has the form[^1]
$$\begin{aligned}
\label{kernel}
\kappa( y,x) = K(z=y-x)
\end{aligned}$$
In detail, we will concentrate on the Lorentz integral transform (LIT) ($\sigma_i >0$ fixed) $$\begin{aligned}
\label{LIT}
K_{LIT} (z) = \frac{\sigma_i}{\pi} \frac{1}{ z^2 +
\sigma_i^2}\end{aligned}$$ which has recently been applied extensively in photo- and electronuclear physics [@EfL07].
In the LIT-approach, due to the choice $\sigma_i \ne 0$, the calculation of physical observables in the $A$-particle scattering problem can be traced back rigorously to the solution of an appropriate bound state problem. This is of course a tremendous technical simplification and offers a unique possibility to carry out rigorous ab initio calculations on few-nucleon systems even beyond mass number $A =4$ [@EfL07]. However, the LIT is known to be ill-posed as will be again outlined below.
In general, in order to obtain $R$ from a given ill-posed transform, an appropriate [*regularization*]{} scheme is essential. For example, in one class of inversion schemes for the LIT, the numerically gained Lorentz transform is expressed as a finite sum of appropriate basis functions whose inversion in explicitly known, i.e.$$L(y) = \sum_{i=1}^N c_i \chi_i(y) \,\, .$$ Due to the ill-posed character of the LIT, the upper value $N$ of basis functions must be limited for obtaining reliable results. Otherwise, the gained solution for $R$ may contain strong, unphysical oscillations. This reduction in the numerical resolution is nothing else as a regularization, see [@AnL05] for further details.
In this paper, we intend to tackle the inversion problem of any ill-posed integral transform of type (\[kernel\]) in a conceptually completely new manner, namely, [*without any use of regularization techniques.*]{} For that purpose, we present in section 2 a new inversion formula for kernels of the type (\[kernel\]) which will then be applied to the LIT. It turns out that this inversion formula directly exhibits the ill-posed character of the LIT. We further provide the spectrum of that LIT kernel, which also makes its ill-posed character evident.
Section 3 is devoted to a numerical case study for the LIT approach, which illustrates the very source for the ill-posed property. A possible reduction of that illness is proposed, i.e. a strategy will be developed to heal, at least under certain circumstances, the ill-posed character of the LIT. We end with a brief summary in section 4.
Mathematical properties of kernels including the LIT
====================================================
For kernels of the type (\[kernel\]), eq. (\[int1\]) has the form $$\begin{aligned}
L(y) = \int_0^{\infty} dx K(y-x) R(x)
\end{aligned}$$ which Fourier transformed leads to $$\begin{aligned}
\label{int3}
\tilde L(k) = \sqrt{2 \pi} \tilde K(k) \tilde R(k)
\end{aligned}$$ with $$\begin{aligned}
\label{Fourier_def}
\tilde f(k) = \frac{1}{ \sqrt{2 \pi}} \int_{-\infty}^{\infty} dy
e^{i ky} f(y)\end{aligned}$$ for any function $f$. Immediately, from (\[int3\]), it follows the inversion in [*closed*]{} form $$\begin{aligned}
\label{inversion}
R(x) = \frac{1}{2 \pi} \int_{-\infty}^{\infty} dk \frac{\tilde
L(k)}{ \tilde K(k)} e^{ - ikx}\end{aligned}$$ Provided that the Fourier transform $ \tilde K(k)$ of the kernel is a continuous function and that the infinum of its absolute value has a lower bound larger zero, i.e. $$\label{int5}
{\cal C} = inf |{\cal K}| > 0\,\, ,$$ we obtain for the $L_2$ norm $$\label{int6}
||R||^2 \equiv \int_{-\infty}^{\infty} dx |R(x)|^2 \leq \frac{1}{
4 \pi^2 C^2}
||L||^2\,\, .$$ In consequence, we can formulate a very simple criterion to distinguish between ill-posed and well-posed integral kernels of the type (\[kernel\]). If ${\cal C} > 0$ is fulfilled, the integral transformation is well-posed. Otherwise, it turns out to be ill-posed, as it becomes obvious by studying the spectrum of integral kernels of the type (\[kernel\]). It is defined as $$\begin{aligned}
\int_{-\infty}^{ \infty} dx K(y-x) \chi_{k_0} (x) =
\mu(k_0)\chi_{k_0} (y) \,\, ,\end{aligned}$$ or Fourier transformed as $$\begin{aligned}
\sqrt{2 \pi} \tilde K(k) \tilde \chi_{k_0} (k) =\mu(k_0)\tilde
\chi_{k_0} (k) \,\, .\end{aligned}$$ This leads to $$\begin{aligned}
\tilde \chi_{k_0} (k) \sim \delta( k-k_0)
\end{aligned}$$ and $$\begin{aligned}
\mu(k_0) =\sqrt{2 \pi} \tilde K(k_0) \,\, .
\end{aligned}$$
Therefore, the spectrum of any arbitrary integral kernel of the type (\[kernel\]) is given by its Fourier transform. If a kernel fulfills ${\cal C} = 0$ in (\[int5\]), the spectrum is continuous and has zero as accumulation point. In consequence, the kernel is obviously ill-posed and an unprotected inversion cannot work.
In case of the LIT, $\tilde K(k)$ is given by $$\label{lor2}
{\tilde K}_{LIT}(k)= \sqrt{\frac{1}{2\pi}} e^{-\sigma_i |k|} \,\, .$$ It fulfills ${\cal C} = 0$, its spectrum is continuous, $$\begin{aligned}
\mu_{LIT}(k_0) = e^{ - \sigma_i | k_0|}
\, \, ,\end{aligned}$$ and approaches zero for large $k_0$. Therefore, the LIT is ill-posed. Its eigen functions are given by $$\begin{aligned}
\chi_{k_0} (x) \sim e^{ i k_0 x}
\,\, .\end{aligned}$$
A numerical case study for the LIT
===================================
The application of the inversion formula (\[inversion\]) requires a reliable numerical treatment of Fourier transforms. In this work, this is performed with the help of Filon’s integration formula [@AbS64]. In order to check our numerical routines, we take a simple analytical test case for the function $R$: $$\label{lor5}
R(x) = \sqrt{x} e^{-ax} \Theta(x) \,\, ,$$ with $\Theta$ denoting the Heavyside step function, i.e. the threshold of this function is placed at $x=0$. $a$ is a free parameter which we choose from now on as $a=0.05$ MeV$^{-1}$. Following the nomenclature in literature, we call $R$ from now the response function. Its Fourier transform is known analytically $$\label{fourier_ana1}
{\tilde R}(k)= \sqrt{\frac{1}{8}}
\, \left( \frac{1}{a^2+k^2}\right)^{\frac{3}{4}}
e^{i\frac{3}{2} \mbox{atan} \left(\frac{k}{a} \right)}$$
so that the quality of our numerical routines for the Fourier transform can be tested straightforwardly. For that purpose, we cut at first the integrations bounds in (\[Fourier\_def\]) according to $$\begin{aligned}
\label{Fourier_def2}
\tilde R(k) = \frac{1}{ \sqrt{2 \pi}} \int_{-\infty}^{\infty} dx
e^{i kx} R(x) \longrightarrow \frac{1}{\sqrt{2\pi}}
\int_{-x_{max}}^{x_{max}}
dx e^{i kx} R(x)\end{aligned}$$
with $x_{max}= 3000$ MeV. With respect to the strong exponential decrease of our test function (\[lor5\]), this upper value for $x_{max}$ is more than sufficient. The remaining integral in (\[Fourier\_def2\]) is now evaluated with the help of Filon’s integration formula using $N$ equidistant grid points. It turns out that the numerical precision in calculating the Fourier transform increases naturally with increasing $N$, but decreases strongly with increasing argument $k$ of the Fourier transform. For example, for $N=20001$ mesh points the numerical error in the real part of the Fourier transform is of the order of about 1.7 percent for $k = 0.8\, \mbox{MeV}^{-1}$, increasing to about 6.9 percent for $k = 2.0\, \mbox{MeV}^{-1}$.
At next, let us check the inversion formula (\[inversion\]) for our test response (\[lor5\]). For that purpose, we calculate at first numerically the LIT transform $ L(y)$ of $ R(x)$ and then its Fourier transformations ${\tilde L}(k)$ corresponding to (\[Fourier\_def2\]) with $x_{max}=3000$ and $N=20001$ equidistant mesh points. Then, with the help of the known Fourier transform of the Lorentz kernel (\[lor2\]), we can perform the inversion (\[inversion\]) where we again, similar as in (\[Fourier\_def2\]), have to cut the integration at the lower and upper limit, i.e. $$\begin{aligned}
\label{inverse2}
R(x) = \frac{1}{2 \pi} \int_{-\infty}^{\infty} dk \frac{\tilde
L(k)}{ \tilde K_{LIT}(k)} e^{ - ikx}
\longrightarrow
\frac{1}{2 \pi} \int_{-k_{max}}^{k_{max}} dk
\frac{\tilde
L(k)}{ \tilde K_{LIT}(k)} e^{ - ikx}.\end{aligned}$$ This second Fourier integral is calculated with Filon, considering again $N=20001$ equidistant mesh points in the interval $[-k_{max},k_{max}]$.
In order to obtain in general a quantitative estimate for arising numerical uncertainties, we define in this context the quantity $$\label{delta2}
\epsilon = \frac{||R^{num}(x)-R(x)||^2}{||R^{num}(x)||^2}$$
with $R^{num}$ denoting our numerical result for the real part of the response derived via the inversion formula (\[inversion\]). Concerning the norm $||$, we use (\[int6\]), i.e. the $L_2$ norm.
In our first attempt, calculation [**A**]{}, we choose $k_{max} \equiv
k^{A}_{max}=0.8$ $\mbox{MeV}^{-1}$ in (\[inverse2\]). The resulting response ($\epsilon=2.2 \,\, 10^{-3}$, dashed curve in Fig. \[fig1\]), using (\[inverse2\]), turns out to be qualitatively correct beyond the threshold region, but unsatisfactory at threshold. The reason for this failure and a convenient improvement will be discussed below. Apart from that point, we can conclude that our new inversion formula (\[inversion\]) works, at least in principle for a LIT with arbitrarily high precision. In practical applications, however, the LIT $L(y)$ is not known perfectly well. In order to take this important fact into account in the present case study, we proceed as follows. We take, for a given value of $y$, the exact Lorentz transform of (\[lor5\]) (“exact” within the limits of the compiler precision) in the form $0.x_1x_2x_3x_4x_5...\,\,\,10^{-d}$ with $x_i,d$ integer numbers and $x_1 \neq 0$. Then, we substitute this number by hand according to $$\label{mod}
0.x_1x_2x_3x_4x_5x_6...\,\,\, 10^{-d} \quad \longrightarrow
\quad 0.x_1x_2x_3\,\,\, 10^{-d} \,\, ,$$ i.e. we cut all relevant digits beyond the first three ones. This ad hoc procedure simulates a numerical error in $L$ in the range $\sim 10^{-3} - 10^{-2}$ – a level which can, under favourable conditions, reached in state-of-the-art calculations in nuclear physics. This modified Lorentz transformation, used from now on in this work, can hardly be distinguished from the original one. However, the resulting response function, yielded by the application of (\[inversion\]), shows large oscillations ($\epsilon=5\, \, 10^{-2}$, dotted curve in Fig. \[fig1\]). This calculation is denoted from now on as [**calculation B**]{}. This numerical fact shows insistently the well-known ill-posed character of the Lorentz integral transformation: a small change in $L$ (lhs. of (\[int1\])), generated in our test case by the modification (\[mod\]), leads to large changes in the response $R$ (rhs. of equation (\[int1\])).
As a novel feature, our inversion procedure allows now to pin down precisely the source for the ill-posed character of the Lorentz transform. For that purpose, Fig. \[fig2\] shows for calculation A and B the real part of the corresponding Fourier transforms ${\tilde R}(k)$ yielded via (\[int3\]), i.e.$$\label{int12}
{\tilde R}(k)=
\frac{1}{\sqrt{2\pi}} \frac{{\tilde L}(k)}{{\cal K}_{LIT}(k)}\, .$$ One obtains a remarkable fact. For arguments $k>0.4$ MeV$^{-1}$, the Fourier transform yielded in calculation B (dashed) differs considerably from the “exact” result A (full). This can be easily understood by the explicit form of ${\tilde K}_{LIT}(k)$ (\[lor2\]). Its inverse is growing exponentially so that in (\[int12\]) even small errors in ${\tilde L}(k)$ are tremendously amplified. This fact also explains intuitively why for small arguments $k$ both Fourier transforms are almost identical. This important result can also be understood from a more rigorous point of view. For $k \rightarrow
0$, we have $$\label{eq101}
\lim_{k \rightarrow 0} \sqrt{2 \pi} {\tilde R}(k) = \int dx R(x) = \int dy L(y)
\,\, ,$$ where the last equation follows from the structure of Lorentz kernel (\[LIT\]). In consequence, if the LIT $L$ contains only a small error, then the last integral in (\[eq101\]) will also contain only a small error. Therefore, the Fourier transform ${\tilde R}(k)$ can be determined with great precision for $k \rightarrow 0$ via (\[int3\]) – despite that the LIT is ill-posed.
Let us summarize this important result again: The LIT is an ill-posed integral transform. However, this ill-posed character does not affect at all the numerical stability of the obtained Fourier transform ${\tilde R}(k)$ of the resulting response for sufficiently small arguments $k$. Only for moderate and large arguments $k$, numerical instabilities arise which can be traced back to the ill-posed character of the LIT.
[*In consequence: If it were possible to determine, from general principles, the asymptotic behaviour of the Fourier transform ${\tilde R}(k)$, one could hope to circumvent, or at least to reduce significantly, any arising numerical instability problems due to the ill-posed character of the LIT.*]{} From a certain point of view, the ill-posed character of the LIT could be “healed”.
For our case study, we proceed now as follows. At first, we have to fix the value $k_{thres}$ up to which the ill-posed character is irrelevant for the determination of ${\tilde R}(k)$ via (\[int12\]). Unlike as in our case study, the exact Fourier transform ${\tilde R}(k)$ is of course not known in general. In practice, one could help oneself by repeating the calculation for a slightly different value $\sigma_i$. In an ideal calculation, without any numerical errors, the resulting Fourier transform ${\tilde R}(k)$ should of course be independent from the chosen value $\sigma_i$. In Fig. \[fig2\] the real part of ${\tilde R}(k)$ can be compared for our standard value $\sigma_i =10$ MeV (dashed) to the one for $\sigma_i =11$ MeV (dotted). Till about $k=0.25$ MeV$^{-1}$, both Fourier transforms are almost identical, however, especially for arguments larger than about $k=0.4$ MeV$^{-1}$ substantial differences arise. Therefore, we could trust our results only till about $k_{thres}=0.25$ MeV$^{-1}$. For $k > 0.25$ MeV$^{-1}$ we have to substitute the unphysical result obtained in calculation B by a more reasonable one. For that purpose, we exploit general theorems on the asymptotic behaviour of Fourier transforms [@Lig58; @BrS70]. It turns out that quite in general the latter is unambigiously fixed by the knowledge of the threshold behaviour of the response function $R$. Now, the threshold behaviour of $R$ is, for a given reaction, in general known from basic physical principles. Without any considerable loss of generality, we can therefore assume that we know not only in our case study, but quite in general the threshold behaviour of our unknown response (\[lor5\]), i.e.$$\label{thres1}
R(x) \sim \sqrt{x} \, \, .$$ Due to [@BrS70], its Fourier transform must therefore behave asymptotically as $$\label{thres2}
\tilde R(k) \sim \frac{1}{\sqrt{k}^3} \, \, ,$$ in agreement with the exact analytical result (\[fourier\_ana1\]).
Now, it is almost straightforward how to proceed. Only for $k < k_{thres}$ we use in (\[inverse2\]) numerical results for $\tilde L(k)$. For $k > k_{thres}$, we use instead the asymptotic ansatz (compare with (\[int3\])) $$\label{asy4}
{\tilde L}_{asy}(k) = \sqrt{2 \pi} \tilde K(k) \tilde R_{asy}(k)$$
with $$\label{asy5}
\tilde R_{asy}(k) = \frac{c}{\sqrt{k}^3} \,\, .$$ The complex parameter $c$ is choosen to guarantee a continous integrand at $k= \pm k_{thres}$ in (\[inverse2\]). By this prescription, it is of course easily possible to extend the limit $k_{max}$ in (\[inverse2\]) to arbitrarily large values without any arising numerical errors. In the resulting calculation [**C**]{}, we choose $k_{max}=10$ MeV$^{-1}$ with again $N=20001$ equidistant mesh points in the region $[-k_{max},k_{max}]$. The resulting response is depicted as the dashed curve in Fig. \[fig3\] ($\epsilon = 4.2 \,\, 10^{-4}$). One readily realizes two very important improvements: (i) The heavy oscillations found in calculation B have vanished, (ii) the threshold behaviour is considerably improved compared to calculation A. Both features can be traced back to the improved treatment of $\tilde L(k)$ by exploiting the known asymptotic behaviour of $\tilde R(k)$. Since we assume that we know the threshold behaviour of the response, the still arising problem of a small, but nonvanishing numerical result for $R(x)$ below threshold is irrelevant in practice.
In general, for an unknown response, it is of course not clear whether the asymptotic form is already working for $k = k_{thres}$ where the Fourier transforms $\tilde R(k)$ start to diverge from each other for different choices of $\sigma_i$. The present case, considers, from that point of view, even an “almost” worst case scenario, since the Fourier transform is decreasing rather slowly, ${\tilde R}(k) \sim \frac{1}{\sqrt{k}^3}$. It turns out that for $k =0.8$ MeV$^{-1}$, the asymptotic form and the exact form of the real part of the Fourier transform, (\[asy5\]) vs. (\[fourier\_ana1\]), differ by not less than about 40 percent. Nevertheless, even this quite reduced precision in the knowledge of $\hat R(k)$ for $k$ at quite moderate values beyond $k_{thres}$ is absolutely sufficient to obtain reasonable results in the inversion of the LIT. If the Fourier transform decreases stronger, e.g. exponentially, one can expect even more reliable results within our proposed inversion technique.
Summary
=======
We illuminated the ill-posed character of the LIT approach by providing an exact inversion formula and giving the spectrum of the LIT kernel. The exact inversion formula requires the Fourier transform of the LIT transformed response, which has to be obtained numerically, whereas the Fourier transform of the LIT kernel is analytically known. Since $ \tilde K^{-1}( k) $ occurs in the inversion formula, even small numerical errors in $ \tilde L(k)$ at large $k$-values are drastically enhanced which lead to violent oscillations of $R(x)$ in the inverse Fourier transformation. We illustrated that situation in a numerical test case. Evaluating $L(y)$ and its FT very precisely and using the inversion formula we recovered the model response $R(x)$ with satisfactory precision, at least beyond the threshold region. However, truncating $L(y)$ to about three digits revealed very drastically the ill-posed character of LIT, namely leading to wild oscillations in $R(x)$ evaluated by the inversion formula. It is not the behaviour of $ \tilde L(k)$ for small $k$-values which causes the oscillations but the behaviour for the large $k$-values. This is clearly demonstrated by putting $ \tilde
L(k)$ to its known asymptotic behaviour for $k$ larger a certain $k_{thres}$. The resulting $ R(x)$ gained through the inversion formula is close to the exact one, without oscillations. In this framework, also the threshold behaviour of $R(x)$ can be reproduced satisfactorily.
As not oulined in this work, we verified in addition that for a more structured model response with two peaks, like the one used in [@AnL05], that inversion formula works equally well, provided one corrects again the asymptotic behavior of $\tilde L(k)$.
In the applications of LIT to electro weak processes in nuclear physics, $ L(y)$ can be determined in various manners, see [@EfL07] for further details. Using our inversion formula, the Fourier transformed $ \tilde L(k)$ of a numerically gained LIT is required. We conjecture that our results lead to the requirement to determine $ L(y)$ with such a high precision that its Fourier transform is well under control for small and intermediate arguments, but not necessarily for large arguments. If this is guaranteed, and if the threshold behaviour of the response is known, the proposed method allows to heal the ill-posed character of the LIT [*without any use of regularization techniques*]{}. From a conceptual point of view, this a very remarkably result.
Since our proposed ansatz is quite general, provided the integral kernel is given in the form (\[kernel\]), one can apply the techniques developed in this work to a variety of different other ill-posed problems in physics and engineering.
[99]{} J. Hadamard, Princeton University Bulletin 13 (1902), 49
V.D. Efros, W. Leidemann, G. Orlandini, N. Barnea, J. Phys. G: Nucl. Part. Phys. 34 (2007), R459
D. Andreasi, W. Leidemann, Ch. Reiss and M. Schwamb, Eur. Phys. J. A 24 (2005), 361
M. Abramowitz and I. Stegun (eds.), Handbook of Mathematical Functions, Dover (1965)
M.J. Lighthill, Introduction to Fourier Analysis and Generalized Functions, Cambridge Monographs on Mechanics and Applied Mathematics, 1958
Yu. A. Brychkow and Yu. M. Shirokov, Theoretical and mathematical physics, Vol. 4, No. 3 (1970), 847
[^1]: Please note that in the usual definition, no factor $\frac{\sigma_i}{\pi}$ occurs in (\[LIT\]).
| {
"pile_set_name": "ArXiv"
} |
The dark phase improves genetic discrimination for some high throughput mouse behavioral phenotyping.
Dark-phase testing has previously been shown by others to improve the outcome of some 'classical' behavior test situations. However, the importance of such ethological correctness and the effect of the light/dark cycle on high throughput behavioral testing situations such as 'mutant vs. wild type' and 'screening', are less or unknown, respectively. These testing situations differ from the 'classical' in that they are designed primarily to discriminate between genetically different mice rather than provide a detailed assessment of ability or psychosocial state. Here we test the hypotheses that dark-phase testing affects the outcome of high throughput behavioral tests and that dark-phase testing improves discrimination between genetically distinct mice (C57BL/6J, 129S1/SvImJ and B6129F1) using high throughput behavioral tests. Our results demonstrate that, although all successful tests showed some effect of phase, only the SHIRPA primary screen, open-field test and motor learning on the rotarod showed improved strain discrimination in the dark phase. Surprisingly, the social interaction test did not show a clear benefit to either phase, and interestingly, the tail-flick test discriminated strains better in the light phase. However, since the preponderance of our data shows that dark-phase testing improves, or does not affect, strain discrimination, we conclude that for these strains and tests, dark-phase testing provided superior outcomes. If discrimination is not achieved in the dark phase, then light phase-testing would be undertaken. | {
"pile_set_name": "PubMed Abstracts"
} |
{\rtf0\ansi{\fonttbl\f0\fswiss Helvetica;}
{\colortbl;\red255\green255\blue255;}
\paperw9840\paperh8400
\pard\tx560\tx1120\tx1680\tx2240\tx2800\tx3360\tx3920\tx4480\tx5040\tx5600\tx6160\tx6720\ql\qnatural
\f0\b\fs24 \cf0 Engineering:
\b0 \
Some people\
\
\b Human Interface Design:
\b0 \
Some other people\
\
\b Testing:
\b0 \
Hopefully not nobody\
\
\b Documentation:
\b0 \
Whoever\
\
\b With special thanks to:
\b0 \
Mom\
}
| {
"pile_set_name": "Github"
} |
Q:
What would be a good kit for cardboard construction projects for a pre-teen?
I really enjoyed making things out of cardboard as a kid and my daughter (10) loves physical construction as well. Some of the things I'd like to provide her tools for :
Easily cutting cardboard
Klever Cutter (cost is about $3 ea. but I suspect they don't last long. Can't replace the blade.
Skil powered cutter (downside: expensive and a bit more dangerous)
Powered scissors - Seems like the best option.
Connecting Cardboard. I'm thinking maybe brads.
What would be a good selection of materials and tools to provide my daughter that would allow her to make cardboard-based construction projects safely? What level of supervision would be required given the materials recommended?
A:
[I'm reposting my answer from your cardboard-cutting question at DIY.SE here, since it was closed there as off-topic.]
When I was the age to be cutting holes in cardboard boxes for fun, the tool I had was a serrated knife — I think it was sold as a very cheap steak knife. The blade was, basically as dull as a letter opener (and somewhat flexible), but the serrations made it quite effective at cutting cardboard like a saw, either neatly or roughly depending on the force applied. It did have an end pointy enough to require some care, but that was never a problem that I recall. It also makes a great noise when cutting a large panel, especially the side of a box, as the cardboard vibrates.
I don't have any specific product recommendations as this was a few decades ago, but I do want to emphasize that this is a dull knife — the serrations do the work. I think this may be the principle used by "won't break skin" kids' woodworking tool sets, also, but I haven't ever tried one of those.
(This is for corrugated cardboard. On non-corrugated cardboard, the serrated knife will still work but the cut will have a thicker edge of torn-up fibers.)
As to fastening cardboard, I always used clear package-sealing tape. (It's much better looking, and less messy, than duct tape.) You can't peel it off to reuse the cardboard without possibly stripping off a layer from the cardboard, but you can cut the tape and leave it on, if you don't mind the looks.
A:
Powered scissors work very well. My 10 year old daughter can use them independently.
| {
"pile_set_name": "StackExchange"
} |
## A Vampire's Vindication
## Alexis Morgan
Keelie Bronson and Griff Tyler have been adversaries for years, locked in legal battles and enmity over Keelie's belief that Griff was responsible for her father's death. But when Griff's control over his vampire clan comes under attack, Keelie may be the key to clearing his name.
When Griff and Keelie finally meet face-to-face, neither of them are prepared for their fierce attraction. Soon, a moment of weakness unleashes a passion that cannot be denied. But Keelie still wonders: is Griff a good man, or is he the monster she always believed him to be?
## Contents
Chapter 1
Chapter 2
Chapter 3
Chapter 4
Chapter 5
Chapter 6
Chapter 7
Chapter 8
Chapter 9
Chapter 10
## Chapter 1
"The daughter's already on her way home?"
"Yes, sir. Keelie started back as soon as she heard."
To buy himself some thinking time, Griff refilled his glass from the carafe of blood on his desk. Well aware of the half-blood chancellor watching his every move from the video screen, he sipped the O neg with a calm he wasn't feeling. The blood gave him an excuse for his fangs to show other than sheer temper.
From the day she'd left the clan to work for Lydia Bronson, his cousin Dorothy had been ordered to maintain silence about their family connection. So far, she'd held to their bargain.
"Are you sure Lydia will tell her?" He flashed his canines at the screen. "And, cousin, I will know if you're lying."
Dorothy's shoulders slumped in defeat. "Lydia has been refusing all of her medications to keep her head clear, and she's quit confiding in me. Even so, I think her intent is to tell her daughter everything."
"Keep me posted."
Griff disconnected the call, deciding he'd showed amazing restraint by not bashing the computer against the wall. Son of a bitch, the timing couldn't have been worse, but then Lydia had never been concerned about the devastation her rash actions had caused others.
He pinched the bridge of his nose and prayed for patience. He was already under attack on another front. All he could do was hope that Lydia managed to quietly pass into the next world without adding to his problems.
But knowing her, that was probably too much to wish for. Stubborn didn't come close to describing that chancellor when it came to her own agenda. Hell, her arrogance would have done a pureblooded vamp proud. Lydia Bronson would hold off the specter of death with nothing but sheer willpower until she was damn well ready to go.
He considered his options. If he were to show up at her house uninvited, maybe he could stave off the impending disaster that would ensue if she broke silence after all these years. Damage control was everything.
With Lydia about to die, that left him the only other person who knew the truth behind the events of twenty-five years ago. Maybe the past could be laid to rest for good. Then again, perhaps not.
Griff studied the file he'd spread out on the desk, his eyes once again drawn to the pictures of Lydia's daughter, Keelie. Her looks favored her late father Kenneth more than her harpy of a mother except for that distinctive eye color: not quite amber and not quite brown, but somewhere in between, like the color of fresh caramel, rich and sweet.
Not that Bronson women of either generation were either of those two things. Lydia worked, but her part-time teaching job at a small college didn't pay enough to maintain her lifestyle. To make up the difference, she'd been feeding off his finances for years.
Then there was the daughter, an environmental scientist and a born crusader. She'd scrutinized every enterprise his clan was involved in since she'd finished college. Keelie had kept Griff on his toes, knowing that she was waiting to pounce at the first hint that any of his clan's actions threatened the native flora and fauna.
Although it certainly pissed him off, he admired her persistence. It was her way of striking back at the vampire she held responsible for her father's death. Oh, yes, if Lydia opened her mouth, his world wouldn't be the only one to be turned upside down. Keelie Bronson was in for a major shock.
Rather than watch his life unravel from a distance, he'd confront Lydia and try to talk some sense into her. Soon the sun would set, and he'd be on his way.
Keelie slammed her transport into Park and ran for the house. She hadn't slept more than a handful of hours in three days as she'd hiked, flown and then driven like a madwoman to get back home. Exhaustion burned like acid in her brain, leaving room for only two questions.
Had she made it in time? And how would ever she forgive herself if she hadn't?
The front door swung open before she was halfway to the porch. Dorothy, the family housekeeper, stood framed in the doorway. There was no need to ask if the past few days had been hard on her. It was written there in the slump of her shoulders and the sorrow in her eyes. Even so, she answered the question that Keelie couldn't find the words or the courage to ask.
"She's waiting for you."
Relief tasted sweet. Keelie slowed to a stop after reaching the porch, reluctant to enter the house. Once she crossed that threshold, brutal reality would have to be faced, acknowledging her mother was dying.
Leaning back against the railing, she struggled to compose herself. It wouldn't do to go charging into her mother's bedside in a full-out panic.
"Tell me what happened."
Dorothy glanced back over her shoulder before joining Keelie outside, pulling the door closed behind her.
"Saturday she worked in the garden. She always says digging in the dirt soothes her spirit after a week full of dealing with fools."
Dorothy and Keelie exchanged smiles. They both knew Lydia had zero tolerance for idiots or incompetence. It was one of the things that Keelie shared with her maternal parent.
"When I looked out, she'd collapsed. The doctor had warned her to take it easy because the lymphoma had progressed to the point that this could happen at any time."
Shock sent a painful jolt straight through Keelie. "When did he tell her that? Why hadn't she told me?"
In fact, why hadn't Dorothy?
"Your mother doesn't tolerate weakness in anyone, least of all herself. I would've told you myself, but she threatened to fire me if I did."
Dorothy's eyes filled with tears. "Seriously, Keelie, the way she was acting, I've been afraid she'd actually throw me out in the streets."
"She wouldn't have." Maybe. One of the symptoms of the disease was erratic behavior bordering on paranoia.
Dorothy stared out toward where the sun was slipping down beyond the horizon. "There's nothing to do now except keep her comfortable. She's been refusing any pain medication, claiming she needed to keep her wits about her until she talks to you."
The housekeeper gave Keelie a considering look. "Whatever she wants to talk to you about must be powerfully important."
Each word stabbed like a dagger into Keelie's heart. It was bad enough that she'd been off playing when her mother's illness took a turn for the worse.
"I don't have any idea what it's about. Do you?"
"No, she quit confiding in me months ago." The hurt in Dorothy's voice was obvious. "We used to be friends."
Keelie threw her arms around Dorothy and gave her a fierce hug. "You're still her friend, Dorothy. It's the disease talking, not Mom."
Dorothy stood back, her hands on Keelie's shoulders. "How did you grow up to be so smart?"
"I had the good fortune to have two terrific role models, Dorothy. You and Mom."
It was time. Facing what was waiting for her inside wasn't going to get any easier.
"Is she in bed?"
Dorothy nodded. "She's too weak to sit up more than a half an hour at a time, but maybe seeing you might perk her up some."
Keelie braced herself. "Look, I'll sit with her for a while. Why don't you take a break?"
Dorothy led the way back inside. "I do have errands to run. I won't stay gone long, though, and I'll bring dinner back with me."
"Dorothy, you're a godsend. Go run your errands and then relax awhile."
The older woman still hesitated. "Are you sure?"
Keelie forced herself to nod. "We'll be fine."
That was a lie, and they both knew it. Nothing would ever be fine again.
## Chapter 2
Keelie stood over her mother's bed in the gathering darkness, her heart breaking. The strong, vibrant person she'd always known was gone, replaced by a frail ghost of the woman Lydia Bronson used to be. Her life could now be measured out in hours and minutes, and the clock was ticking. Soon Keelie would be alone. Yes, she loved Dorothy, but it wasn't the same. She and her mom had been close and for good reason.
After her father's brutal murder, they'd turned to each other for comfort. His killer had never even been brought up on charges for her father's death. Because Griffon Tyler was a member of a wealthy vampire clan, no one had questioned his claim that the death had been accidental. For Keelie's father there had been no justice, no vengeance, no retribution. She closed her eyes and fought against the familiar burn of hatred.
Because of that vampire, Keelie had grown up without a father, and her mother had grown colder as the years had gone by. Maybe it had been the disease that destroyed her mother's smile, but more likely it had been grief and bitterness.
"Mom."
No response. Keelie would've been scared, but she could sense the faint flutter of her mother's pulse. The only question was if her mother was asleep or if she'd slipped into a coma. Did she really want to know which it was? No, but walking away wasn't an option.
Touching her mother's shoulder, Keelie gave it a light shake. "Mom, I'm back. Dorothy said you wanted to talk to me."
This time her mother stirred, her eyes fluttered, then opened wide to stare up at Keelie. At first there was nothing but confusion reflected in their amber depths. Keelie gave her mother a few seconds to gather herself.
Finally, there was a glimmer of recognition and her mother's mouth offered a hint of a smile. "You're back."
She gathered her mother's frail hand in her own. "Sorry it took me so long to get here."
"Dorothy?"
"She's out running errands. She won't be gone long, but she just left."
"Good." Lydia struggled to sit up. "Must talk."
Keelie lifted her mother up enough to tuck another pillow behind her. Even that much effort left the older woman struggling to breathe.
"Take it easy and rest, Mom. We can talk later after dinner."
Her mother grew more frantic, more insistent. She squeezed Keelie's hand with a chancellor's strength. "No! Now. Before she's back. Dorothy will tell him. I know she will. She doesn't know I heard her talking to him."
Him? She must mean her doctor. He'd warned them that the natural progression of the lymphoma could bring on paranoia and unexplained agitation. Keelie fought to present a calm façade to her mother, hoping to soothe her fears.
"Mom, please, Dorothy is your friend. She'd never do anything to hurt either one of us."
Lydia's head jerked back and forth, adamant in her denial. "She works for him. I know she's been lying to us. You need to know the truth about everything. Before it's too late. I'm so sorry. My fault. Should have said something before now."
"Said something about what?"
Tears trickled down her mother's papery cheek. "That night. Back then...seemed right. But the lie spun out of control."
Feeling shaky herself, Keelie sank down to the floor next to her mother's bed. She brushed her mother's hair back from her face, buying herself a few seconds. Dread settled in her stomach, sending cold shivers of fear scattering along her nerves.
"What night, Mom?"
Although she knew. There was only one night that could carry such dread weight in her mother's voice.
"You know. That night. When I...when Kenneth...death and blood. So much blood." As the words faded away, her mother licked her lips and her eyes lost their focus, perhaps seeing the past so much more clearly than the present. Just as quickly she was back, looking at Keelie with burning intensity.
"I left a letter. It explains everything. Tell him...sorry, so sorry."
Her mother paused to catch her breath. When she didn't continue, Keelie prompted her, knowing her mother wouldn't rest easily until she got it all out.
She couldn't mean Keelie's father. Surely she wasn't that confused. "Tell who you're sorry, Mom?"
Lydia started to speak and then her eyes widened in horror as a deep voice answered the question for her.
"I suspect she means me."
Keelie lurched to her feet, planting herself firmly between her mother and the vampire standing in the doorway. Her fangs dropped down as she stood ready to defend them both if he took one more step into the room.
Griff didn't know whether to laugh or applaud Keelie Bronson's determination to protect her mother from him. Not that he'd make the mistake of underestimating her. The North American Coalition employed chancellors to police both humans and vampires for good reason. She might just be able to take him in a fair fight, but then he never fought fair.
Right now Keelie hovered on the brink of attack, those caramel-colored eyes boring straight into his in full challenge. His own predatory instincts bubbled to the surface. Under other circumstances, he might've tried to coax her into channeling all that high-octane emotion into a different, more pleasurable direction.
Right now, if he even so much as hinted how aroused he was by her display of temper, she'd be on him, no holds barred. He eased back half a step, forcing his shoulders to drop and his hands to dangle at his side, hoping she'd accept that he posed them no immediate threat. Slowly the tension sizzling in the air between them settled down to a more manageable level. Barely.
"Who the hell are you?" she snarled.
He arched an eyebrow and offered her a small shrug. "Don't play games, Keelie. Even if we've never spoken in person, Lydia's reaction should tell you who I am."
He let a hint of his own fangs show when he spoke. "Besides, considering all the injunctions you've filed against me over the past few years, I can't believe you don't recognize me."
"Griffon Tyler."
Lydia whispered his name, the words so faint that only those with vampire DNA would've been able to hear them. Her daughter certainly had. Keelie flinched and stepped back closer to her mother.
"Don't worry, Mom. Mr. Tyler is leaving."
Griff leaned against the doorframe and crossed his arms. "No, actually I'm not."
He hated to ramp up the tension again, but he wasn't going anywhere before they settled a few things. Damn Lydia for putting Keelie through all of this. If the woman had dealt with their mutual problem sooner, Keelie wouldn't be the one stuck in the middle.
Keelie glanced at her mother before turning her angry gaze back in his direction. "You will leave and leave now. Can't you see that she's sick?"
Damn, he hated the pain in Keelie's voice, the one innocent in all of this. "We'll compromise. I'll go as far as the living room."
Before he did, though, he had one more thing to say. "Lydia, she's going to find out. Wouldn't you rather she hear the truth from you?"
As he spoke, his hand reached out toward the daughter in a futile attempt to offer her some kind of comfort. She clearly wasn't interested. He couldn't blame her.
On his way out, he gave her his parting shot. "Come talk to me when you're ready."
Then he walked away before Keelie could argue the point any further.
## Chapter 3
Griff Tyler was no longer in sight, but Keelie could still feel the power of his presence echoing throughout the house. She'd actually taken a couple of steps as if to follow him before catching herself. Staring at the empty doorway, she wondered at her strong reaction to the vampire. He certainly wasn't what she'd expected. In the past, they'd dueled via legal documents, never over the phone or in person.
Certainly, his arrogance had come across quite clearly in their correspondence, but that hadn't prepared her for the impact he'd have on her senses. Her own temper had heightened her awareness of him as he'd filled the doorway with his tall frame and broad shoulders. He wasn't the pretty-boy spoiled heir she'd pictured. Instead, he had those predator's eyes that saw too much and a nose that had been broken once too often, making his face rugged rather than handsome.
She doubted he smiled often. But when he did, she bet it was devastating, especially with that impressive set of canines he was sporting. She shivered.
Her mother drew Keelie's attention back to her. "Keelie."
Lydia's hands worked the edge of the blanket, clearly agitated.
"Mom, what is it?"
Although she didn't want to know. Once again she knelt at her mother's side, wishing all of this would just go away.
A strange calm settled over her mother's expression, erasing years off Lydia's face. Her eyes dropped to half-mast, her hands still at last. When she spoke, there was a resurgence of strength in her voice.
"I'm sorry, Keelie. I was a coward then, and I'm a coward now. I loved your father, and I love you. I see so much of him in you."
Her hands went back to tugging at her covers. "I left a letter in my desk. You know, the secret compartment. Remember the game we used to play so you'd know how to open it?"
Keelie nodded. The hidden door could only be released if the desk drawers were opened and closed in the right sequence.
"Good. Find the letter. Read it. Take any questions to Griff. He'll know the answers. He's strong."
"Mom, you're scaring me."
On so many levels. She knew a goodbye when she heard one, but was her mother really asking her to trust the vampire she'd spent the last twenty-five years reviling? Was this the disease speaking? Somehow Keelie didn't think so.
She captured her mother's hands, hoping to calm her. They were cold, too cold. Lydia stared up toward the ceiling, a smile slowly spreading across her face.
"Kenneth, I knew you'd come."
The words floated on a whispered breath—and then her mother breathed no more.
The cry of anguish had Griff running for the bedroom. He'd sensed the nearness of Lydia's death, but doubted Keelie had. She'd been too intent on understanding her mother's confused words to realize that Lydia had been slipping away.
When he reached the bedroom door, he found Keelie huddled on the floor, her chest heaving with huge, wracking sobs. Dorothy would've been better suited to comfort the young chancellor, but his cousin had yet to return. Griff did the only thing he could think of. Grabbing a quilt, he wrapped it around Keelie and then muscled her up off the floor.
He hated—HATED—dealing with a woman's tears, but it would take a lot bigger bastard than he was to drop Keelie in the other room and bolt out the front door. Cursing himself for a fool, he settled them both on the sofa and wrapped his arms around her as she soaked the front of his shirt with her grief.
After a few seconds, he began rubbing her back with one hand, mumbling a bunch of nonsense, hoping the tone of his voice would soothe her even if his words didn't. When the torrent slowed to a stop, he loosened his hold on Keelie, but she made no effort to move away.
"Keelie?"
She'd fallen asleep.
"I'll be damned." He studied the lump of female passed out in his lap. "Now what do I do?"
If he were careful, he might be able to lift Keelie off his lap. At least then he'd be able to track down Dorothy and contact the authorities to report the death. But Lydia wasn't going anywhere, and Keelie obviously needed a few minutes of oblivion to deal with the situation. Why else would she let down her guard around her sworn enemy long enough to fall asleep? He cradled her closer and let her doze.
A short time later Keelie finally lifted her head, her face still blotchy from crying. Her eyes blinked in surprise, as if confused about how she came to be on his lap. He relaxed his arms, allowing her to decide what to do next, hoping she'd make up her mind quickly before he did something stupid. Like kiss her.
Too late.
Griff took it slow, brushing his lips across hers, offering comfort, tasting her tears, and wishing the circumstances were different. He was hardly an innocent when it came to the female of the species, but this was different. Through the growing fog of passion, he fought to put a label on what he was feeling. No luck. The best he could come up with was that somehow she just fit: in his arms, on his lap, maybe in his life.
No, don't go there. Under the circumstances, it was understandable that emotions would run hot. That was no excuse for letting his imagination rampage out of control. He was just feeling overprotective. After all, Keelie's late father had been Griff's best friend. Despite his differences with Lydia over the past twenty-plus years, he'd kept an eye on his boyhood friend's daughter, but always from a distance. Not like this, crushing her against his chest, his tongue down her throat.
But damned if he could find the strength to stop, to call a halt to this headlong rush of heat. He brushed his thumb across the soft skin of Keelie's cheek. Reluctantly, he lifted her off his lap, trying to ignore the brief flash of hurt in her caramel-colored eyes.
He was never at a loss for words but found himself struggling to string together even a simple explanation as to why they needed to stop. "Keelie, we can't...we shouldn't."
Then a noise outside gave him that final push of common sense. "Dorothy's back."
With more regret than he could believe was possible, he walked away.
What had she been thinking? Her mother dies and what does she do? Jump the vampire who killed her father? Keelie's face burned in shame. She watched as Griff Tyler stopped Dorothy to break the news. Two grocery bags hit the ground as the housekeeper reeled in shock. Her grief-stricken eyes looked toward the house as she listened to whatever Griff was telling her.
Finally, Dorothy slowly walked away from the vampire, heading for the porch. Griff remained in the yard, making a call. Keelie opened the door and enfolded Dorothy in her arms as they both dissolved into tears. When the storm had spent most of its fury, Dorothy drew a shaky breath.
"Griff said he'd make the necessary calls. I need to go see to your mom."
Now wasn't the time to ask Dorothy about Lydia's assertions that she'd overheard her old friend talking to Griff Tyler. That would come later. For now, they had a funeral to plan.
"I'll go with you."
## Chapter 4
"Your mother will be missed."
"Thank you."
Keelie managed a small smile as she accepted yet another in a long line of condolences. Would the line ever end? She appreciated everyone honoring her mother's memory, but it wasn't as if Keelie knew many of them well.
Her emotions were stretched to the breaking point. It wouldn't take much to shatter her composure completely. Knowing that Griffon Tyler was lurking along the back edge of the crowd didn't help. He'd kept his distance, but she could swear she sensed every move he made.
She'd tried several times to catch him watching her. But each time her eyes had strayed in his direction, he'd been engaged in conversation with one of the other high-ranking pureblood vampires on the guest list. Griff was definitely working the crowd.
The question was why? What was he after?
None of that would matter if he would conveniently disappear from her life as quickly as he had appeared. Once she settled her mother's estate, Keelie would return to her job where the only contact she had with Griff was through his attorneys. But those same instincts that made her so good at tracking down threats to the environment were screaming that Griff was up to something. He might walk back out of her life, but it would be on his terms, not hers.
Her fingers strayed to her lips, as she relived that moment of weakness when she'd let him kiss her. That had been bad enough, worse was the knowledge she'd kissed him back and was still thinking about it three days later.
And of course, this time when she glanced in his direction, he was looking straight at her. Judging by his slight smile, he knew exactly what she'd been thinking. The egotistical jerk. She wondered again what was contained in the thick envelope she'd found in her mother's desk and what it had to do with Griffon Tyler and the events that had led to her father's death.
Since she couldn't be sure how much Griff had heard of her last conversation with her mother, she'd been reluctant to leave the letter in the desk. As soon as she'd had time, she'd removed it and now carried it with her for safety's sake. Eventually she'd find the courage to open it, but not today and maybe not tomorrow.
The last of her mother's associates paid their respects and then moved on. She thanked them for coming, but all she really felt was relief that she was done playing hostess. Or was she? A late arrival stood in the doorway, looking around the room as if he owned the place. She didn't recognize him, but there was no mistaking the vampire's arrogance and wealth.
He surveyed the room, his lip curled just enough to express his disapproval when he spotted Griff. Who was he? She rose to her feet. The tension between the two vampires spread across the room, making the other guests stir restlessly. Several made a discreet exit.
What was going on? Keelie started across the room, noting the instant that Griff realized she was on the move. He cut through the crowd, heading in her direction. Figuring better the devil she knew, she allowed him to intercept her. He offered Keelie his arm, leaving her no option to refuse without insulting him. She managed to maintain a calm demeanor, but just barely.
"So who is he and why is he here?"
Griff set a roundabout course through the crowd that would eventually take them by the newcomer. He stopped at the buffet table to pick up two drinks; blood for him, wine for her.
"My cousin, Becan Tyler," he finally answered when they were again on the move. "As to why, you'd have to ask him that. He avoids me."
She smiled at Griff over the rim of her wineglass. "One of those nasty little vampire family feuds we hear so much about?"
Griff's eyes turned icy. "A family disgrace is more like it. Becan is hoping you now have proof that would destroy my position in the family. If that happens, he inherits control of the clan's business holdings."
"And I'm supposed to think that's a bad thing?"
Griff's fangs flashed. "Damn straight it is. Trust me on that."
"I have no reason to trust you on anything, Mr. Tyler."
Griff's eyes hardened to the color of jade. "Fine, Keelie. I get that. True, I might be a coldhearted bastard, but Becan makes me look all warm and fuzzy. If you don't believe me, talk to the few humans who've managed to escape from his estate and lived to tell about it."
Despite her mother's strange behavior, Keelie hadn't forgotten Griff's ties to her father's death. She might have kissed the vampire in a moment of weakness, but the last thing she wanted was to be entangled in his clan's politics. She removed her arm from his and put some distance between them.
"Thank you for the information. Now if you'll excuse me, I need to greet my guest."
## Chapter 5
Griff should just let her go. She didn't need him. After all, Keelie Bronson was all grown up, a chancellor in her prime. If Becan were the type to attack directly, she might even stand a fighting chance against him. Unfortunately his cousin had perfected the skill of the sneak attack. If Keelie somehow thwarted Becan's efforts to oust Griffon as clan leader, the bastard would kill her without hesitation, and her death wouldn't come easily.
Griff watched her approach his cousin, telling himself he was merely concerned for her safety, the same as anyone who might be seen as a threat to Becan's plans. That much was true, but Griff tried never to lie to himself. He'd spent the entire evening fighting the need to watch over her, to hover nearby, to find someway to drive away the shadows in those caramel-colored eyes. Maybe even kiss her again if the opportunity arose.
It would be better for all concerned if he kept his distance from both Keelie and Becan. His extended family hardly needed a fresh batch of gossip about the Tylers and the Bronsons circulating among the other vampire clans.
He'd already paid his respects by being there, which meant he could leave in good conscience. He'd wanted to talk with Dorothy about the letter Lydia had left behind but couldn't do that now. The last thing he wanted to do was draw Becan's attention to her presence. But come to think of it, he hadn't seen Dorothy since Becan had appeared. Good thinking on her part.
Elitist bastard that he was, Becan had made Dorothy's life a living hell when they were younger because of her mixed blood. As soon as she was old enough, she'd deserted the clan's stronghold to make a life for herself among the humans and other chancellors.
It was after the death of Keelie's father that Griff had encouraged Dorothy to apply for the housekeeper's position working for Kenneth's widow. The arrangement had worked out for both of them. She'd needed the job, and he'd needed her to keep an eye on things for him.
Unfortunately distance wasn't working for him now. He couldn't hear what Becan was saying, but Keelie's body language was all too clear as she emphatically shook her head and took a step back. Damn it, didn't the woman know never to show a sign of weakness to a predator?
Griff set his glass aside to free up his hands. The crowd scattered in front of him, showing a well-developed sense of self-preservation. No one in their right mind got in the way of a vampire on the hunt.
He openly displayed his fangs as he approached his cousin. Becan stopped talking as Griff headed straight for them. He smiled, but it wasn't friendly, especially with his own impressive set of canines fully extended.
Keelie looked back over her shoulder to see what had brought on the vampire's aggressive reaction.
"Griff, did you want something?" she asked.
Something in her voice caught his attention. It wasn't fear, at least not exactly. Relief, maybe. Either way, her eyes were pleading with him not to make a scene. For her sake he'd try.
"Keelie, I see you've had the questionable pleasure of meeting my younger cousin, Becan."
He met the challenge in the other vampire's eyes with a small smile. Becan hated being reminded of the three-day difference in their ages that had given Griff the decided advantage in the power structure within their clan.
Becan shrugged a shoulder. "I thought someone from our clan should offer their condolences to Miss Bronson, preferably someone who wasn't involved in the death of her father. Tell me, Griff. Any truth to the rumors that you were also present when poor Keelie's mother died?"
As he spoke, Becan's hand snaked out to brush against Keelie's cheek. She flinched, clearly hating the feel of his touch. She backed away, stopping only when she bumped into Griff.
Her eyes blazing, she glared at Becan, the tips of her own fangs showing. "You need to leave. Now."
The other vampire read her message loud and clear. Griff was welcome. Becan was not. This time his hand snapped out as if to slap her. She deflected the blow before Griff could do it for her. That didn't matter. Becan would pay for trying to harm Keelie.
Griff's rage burned hot. Between one heartbeat and the next, he slammed Becan against the wall, choking the bastard. How dare Becan touch her? Keelie didn't belong to him and never would. She was Griff's alone to claim. To protect. Griff's fangs ached to rip into Becan's throat and drain him dry.
Before he could act on the thought, Keelie grabbed his wrists, using her considerable strength to loosen his hold and allow Becan to suck in enough air to live. What a damn shame. A lot of Griff's problems would be solved if Becan breathed his last.
"Griff, I don't know what's going on between the two of you, but stop this now."
She glared at him until he released his cousin. Becan rubbed his throat and snarled. "You will both pay for this."
Keelie pegged Becan with a hard look. "Either walk out now or I'll toss you out. Right now, I don't really care which it is."
Becan jerked his head toward Griff. "If I go, he goes."
"That's not your decision to make." Keelie took a step closer to the irate vampire. "You weren't invited, he was."
Not really, but Griff wasn't about to argue the point, not when it meant he could stay. His cousin moved as if to go on the attack, but then clearly thought better of facing off against both a pissed-off chancellor and an enraged vampire. That showed more sense than Griff would have credited his cousin with having.
Finally, Becan's resolve broke. He quickly backed out of the door and disappeared into the night.
Becan's departure left Griff with a shitload of aggression and no handy target for it. He stepped outside, drawing a slow breath to test the night air to make sure Becan was really gone. Keelie joined him. Not good. His control was already shaky. With vampires, aggression was aggression, whether it was directed toward an enemy or a potential lover.
He looked around. No enemies in sight.
That left only one possible target: Keelie. The last thing he should be thinking about was taking her up against the brick exterior of the reception hall. At her mother's memorial service. What the hell was wrong with him?
Stupid question. His instincts were thinking how the soft curves of her body would cushion the powerful sex drive of a vampire lover whose temper was running hot. That her mouth, right now set in a grim line, was perfect for long, wet kisses and so many other things.
"You need to go back inside. Now." Before it was too late.
She got right up in his face. "One thing you haven't seemed to figure out, Griffon Tyler, is that I don't respond well to orders. Care to tell me what that was all about?"
Clan business was supposed to be kept secret, but she should know what she was mixed up in. "Becan wants to take over the clan and is looking for any ammunition he can find."
"And you just had to go toe-to-toe in front of my guests?"
"He started it."
Okay, that was real mature. At least his childish remark had softened Keelie's mouth, as if she were fighting the urge to grin. It also made her look ever so kissable.
"I apologize for dragging you into our family problems, Keelie. I won't apologize for going on the attack when he tried to hit you. Next time, I'll kill him."
She looked up at the moon overhead, as if praying for patience. Finally, she looked up at him. "Griff, I handle my own battles. I don't need you to fight them for me. Now everyone inside thinks you were fighting over me like two dogs with one bone."
He liked that she wasn't afraid to challenge him when she wanted to make a point. Unfortunately, it also had the effect of ramping up his predatory nature even more, taking it in a whole different direction.
Damn, his fangs burned to taste her life's blood, knowing it would pack a fiery kick. But not here, not in a parking lot. If he ever bedded Keelie—no, make that when he bedded her, it would be someplace private where he could savor each moment, making sure she took as much pleasure from their joining as he did. He let some of what he was feeling show, tracing the graceful curve of her neck with his fingers.
For the first time, Keelie looked a bit nervous. "Griff, what are you thinking?"
He tongued the sharp tip of his fangs. "You're a smart woman, Keelie. Figure it out."
She backed away in a hurry. Once again, she should've known better than to retreat in front of a vampire. He followed her step for step, not wanting to scare her, but unable to stop himself, not with the urge to mate clouding his head.
"Damn it, woman, stand still before I do something we'll both regret."
He closed his eyes and fought for control. Finally, he crammed the lid back on his temper. He stepped back and bowed slightly.
"I apologize again. Now go inside and make nice with your guests. When you leave, make sure you're not alone. I wouldn't put it past Becan to come sneaking back. He doesn't handle being thwarted very well."
"And you do?"
At least she was smiling. "I'm not sneaky. If I want something—or someone—I'm far more direct in my approach."
Those caramel eyes reflected both the moonlight and a bit of curiosity. "Is that a warning?"
"More like a promise. Now go before I rethink my decision to behave."
Then she surprised them both and grabbed his lapels to drag him down for a kiss. They were both breathing hard when she finally broke it off.
"That still doesn't mean I trust you."
Yes, it did or she'd never have let him stay, much less kiss him.
Rather than point that out, he said, "We still need to talk about whatever it was that your mother left you."
The light in Keelie's pretty eyes immediately dimmed. Perhaps a cloud had passed over the moon, but he was pretty sure that he was the one responsible for that flash of pain.
"I'll be at your house tomorrow sometime after sunset."
She jerked her head in agreement and walked back inside.
Once she was out of sight, he picked out a place where he could watch over the parking lot without being seen. Yeah, she could take care of herself, but it wouldn't hurt for her to have some backup in place. Just in case.
## Chapter 6
Keelie stared up at the ceiling. After her alarm had gone off, it took her a few seconds to figure out exactly where she was. Finally, she remembered checking into the hotel just before dawn.
It had only made sense to stay in town rather than drive all the way back out to the house. Her aunt's attorney had approached her last night after the memorial service asking her to meet with him. With everything else going on, she'd tried to put it off until next week. But he'd insisted the matter couldn't wait, so she'd reluctantly agreed.
Something was definitely going on, but she had no idea what it could be. If it were just her mother's will, surely that could have waited a few days. Nothing was making any sense.
She'd been so tired that she'd barely taken note of her surroundings before tumbling into the bed and falling asleep.
Unfortunately, her dreams had been anything but restful. The image of Becan Tyler's fangs haunted her as he lunged at her throat. When Griffon thwarted his cousin's attack, the flash of his fangs had a totally different effect on her. After vanquishing their mutual foe, Griff had led her in a dance of celebration—as in some of the most amazing imaginary sex she'd ever had. Even now, she ached with the need to finish what her dream self had started. Or maybe she'd kick-started the dream herself by giving into the impulse to kiss Griff last night. What had possessed her to do something so foolish?
She closed her eyes against the confused torrent of emotions flooding through her. How could she be thinking of that vampire in those terms while knowing he'd been involved in her father's death? It made no sense. Had her mother been thinking clearly when she'd told Keelie to trust him? Was Griff a good man and not the monster she'd always thought him to be?
Thinking in circles accomplished nothing. It was time to make some plans. First, she'd get dressed and eat. Then off to see the attorney before going back home. She'd have the place to herself because Dorothy had requested some time off before returning to her duties.
The house would be doubly empty with both the housekeeper and Keelie's mother gone. At least she'd have some privacy while she sorted through things, deciding what to get rid of and what to keep. And maybe she'd finally find the courage to read the letter her mother had left for her.
Time to get moving.
Keelie dug her nails into the palms of her hands, needing that small bit of pain to convince herself that she wasn't caught up in a nightmare. No, she was really sitting across from her aunt's lawyer, who'd just succeeded in destroying her life.
"I'm sorry, Mr. Fogarty," she said, although why she felt the need to apologize for anything escaped her. "Would you repeat that?"
The elderly lawyer sighed and turned his eyes back to the document in his hands. "The aforementioned house belongs to the Tyler vampire clan. You have one week to evacuate the premises, at which time you will turn the keys over to their legal representatives. Failure to do so will result in immediate legal action."
Finally, he set down the thick sheaf of papers and took off his glasses. "I'm sorry, Miss Bronson. I've only been your aunt's attorney for the past five years. She never mentioned any of these arrangements to me. On the plus side, at least she did leave you a tidy amount in a trust fund, enough for a down payment on a place of your choosing."
He sighed heavily again. "As much as I'd love to tell you there's been a mistake, I can't. I've studied this file and even consulted with my partners. There are no loopholes and no explanations why the courts gave Lydia free use of the house for her lifetime."
That's because no explanations were necessary. It had been Griffon Tyler's way of assuaging his guilty conscience.
She was absolutely furious, but the attorney wasn't a suitable target for her anger. If her mother was still alive, they'd definitely be having words over this, but she wasn't. That left one person—Griff Tyler.
And she'd kissed the bastard. Twice. She fought the urge to scrub her lips with the sleeve of her jacket to wipe away all memory of his mouth pressed against hers. She settled for a breath mint.
Rising to her feet, she picked up the copies of the legal documents that Mr. Fogarty had provided her with. "Thank you for..."
Her words drifted to a stop because she couldn't think of one thing she was grateful for.
"I'll be going now."
He followed her to the door. "If there's anything I can do for you, please don't hesitate to contact me. I wish things could have been different."
"Me, too, Mr. Fogarty. Me, too."
Keelie parked her transport in front of the house that was no longer her home while she tried to decide exactly what it was she was feeling. It felt like—nothing. She was numb. She'd lost too much, too fast, for her mind to be able to process any more pain.
For the moment, all she could do was stare at the two stories of wood and glass where she'd lived with her mother since the death of her father. It had never occurred to her to wonder how her mother could afford such a place. As a child, she'd accepted everything at face value, but she'd outgrown that excuse years ago.
She couldn't sit outside all night. There was a ton to pack and not much time to do it. She'd called ahead to have a local moving company drop off a shipping container and a load of boxes.
Time to get started.
After grabbing her suitcase, she headed for the front door. About halfway to the house, the back of her neck started itching, as if someone was watching her every move. When she reached the porch, she set her bag down and slowly looked around, hoping whoever was watching her would think she was simply taking time to enjoy the spectacular sunset.
As soon as she turned, the feeling disappeared. If someone had been out there, he was gone now. Maybe she was being paranoid, but then considering how screwed up her life had become, she had good reason to feel that way.
Time to get the pile of flattened boxes inside and set the deadbolt. She'd feel a whole lot better with the stout thickness of the door between her and the outside world. After half a dozen trips carrying in the packing supplies, she locked the door and headed for the kitchen. She'd eat a quick meal before boxing up her life.
An hour later, she set her dish in the sink. She'd lingered too long over a simple sandwich. No more excuses. It was time to take that first hard step. After picking up a stack of boxes, she eased through the door into her mom's room. Bracing her load against the doorframe, she flipped on the light.
One look at the room and her lungs froze in her chest. The boxes slipped from her hands, clattering to the floor as she stared in shock at the chaos that lay in front of her.
What had happened? The drawers had all been upended on the floor, and the closet had been stripped bare. Even the mattress and box springs had been slashed apart, the stuffing thrown around the room like clumps of dirty snow.
One part of her was in fierce denial at the sight of so much damage, but her heart knew the truth. Far too much hatred and anger had gone into the total destruction for it to be a simple break-in. The intruder had been searching for something. She had to think he hadn't found it. That was the only way to explain the broken and battered remains of her mother's collection of porcelain wolves.
She knelt down to pick up the only one that had somehow escaped unscathed, drawing comfort from its familiar shape. When she could bear to look up, she studied the mess. Where to begin? Calling the police certainly, but they'd want explanations, ones she didn't have.
She'd check out the rest of the house and then decide what to do. Her chancellor hearing would've warned her if someone else was still inside. She peeked into Dorothy's room off the kitchen. Neat and tidy, just like always. Either the intruder didn't think Dorothy had anything worth stealing or else he'd run out of time to search her quarters.
Upstairs, Lydia's home office was a mirror reflection of her bedroom. There wasn't a single surface left unscathed, not an item left unbroken. Keelie ached with grief over so much wanton destruction as she moved down the hall to face her own room.
The door stood ajar. Even from a distance she could see the floor was strewn with a trail of debris. Gathering the tattered remnants of her courage, she took a leaden step forward. Things. They were just things. Not all could be replaced, but she'd still have her memories.
She pushed the door open with her fingertips, still hanging back as far as she could. Eventually she'd cross the threshold, but not yet. Maybe when she could draw a full breath. Maybe when the knot in her stomach loosened.
Maybe never.
Somewhere downstairs glass shattered. A second later, it happened again—closer this time. One more time and she was bolting for the stairs, her fangs running out and demanding a blood price from whomever was out to destroy her life.
She hit the bottom step as a cloud of black smoke came roiling out of her mother's bedroom. Thick and oily, it ghosted through the hallway, consuming all the breathable air. Its mate came slithering out of Dorothy's room, blocking the way to the back door.
Survival instincts took over, thinking for her when she couldn't put a coherent thought together. Choking when she hit the solid wall of smoke, Keelie dropped to the floor and crawled, hoping to buy the few seconds she needed to reach the front door.
Desperate with sure death dogging her footsteps, Keelie crawled over broken glass, grateful for the thick denim of her jeans. In the living room, she grabbed her purse and the overnight bag from the bench by the front door.
Only then did she open the door and go stumbling outside, leaving the nightmare behind her as she ran out into the darkness.
## Chapter 7
Griff yanked the steering wheel hard to the left, sending his transport barreling toward the ditch. Even with his vampire reflexes, he only narrowly missed Keelie as she stumbled out in front of him.
Was she out of her effing mind running out into the road like that?
Then she wheeled around and dropped to her knees. His vampire eyes, better suited to the night than the day, saw all too well the tears streaming down her face as she hugged herself and keened in heartbreaking grief.
What was wrong? Sure, she'd just lost her mother, but that didn't account for why she'd choose to cry in the middle of the road. Even allowing for the fact there wasn't much traffic out this far, she wasn't that stupid. He slammed the vehicle into Park and took off running.
That's when he noticed her face was reflecting a red flickering light. He slowed to a stop in stunned silence. The crackle and pop of a fire raging out of control overrode the normal night sounds. The flames were licking at the roof of her house, the interior already an inferno. Hell, even her vehicle was burning.
He reached for his phone to call it in. It was obviously too late to save the house, but hopefully the fire department could contain the damage to the immediate area. If the flames reached the grasslands behind the house, there would be no stopping it.
While he provided the necessary information, he cautiously approached Keelie. She was clearly caught up in the throes of a powerful emotional meltdown. That was understandable, but it also meant she might not recognize friend from foe.
"Keelie."
No response other than her tears slowed. In stark silence, she stared at the raging dance of the fire lighting up the night. He stripped off his jacket and gently settled it over her shoulders, wishing there was more he could do to ease her pain.
He knelt down on one knee, putting himself at eye level. "Keelie, honey, are you hurt? Were you inside when the fire started?"
She drew a shuddering breath. He still wasn't sure if she really knew he was there, but then she spoke.
"Why would you burn the place, Griff? You ordered me evicted from the house, but the lawyer told me I had a week. Do you really hate me that much?"
Her words, an equal mix of anger and hurt, battered at him over the roar of the approaching fire trucks. He leaned in close to make sure she heard his response.
Gently cupping her chin with his hand, he tipped her face up just enough to make sure she heard him clearly.
"You haven't known me all that long, but that doesn't mean you don't know me well. I have three things to say, and you'd better damn well believe me."
He held up one finger. "First of all, I don't know a damn thing about any eviction notice."
Two fingers. "Even if I had wanted you to move, I wouldn't set fire to the place and risk destroying my only chance of reading that letter your mother left."
When he raised the third finger, he narrowed the distance between them until only a breath of smoky night air separated them. "And I sure as hell don't hate you."
Then he settled his lips over hers, letting his kiss speak of things he wasn't yet ready to put words to. She moaned under his gentle assault, her hands frantically seeking something to hold onto. He guided them up around his neck as he settled her against his chest. When she didn't fight his embrace, he slowly rose to his feet, taking her with him.
The fire department had turned out en masse. Obviously Griff's name carried enough weight to pull out all the stops. Within minutes the road and driveway teemed with men and women carrying axes and dragging hoses. At least no one offered false platitudes about their chances of saving anything as they hosed down the burned-out shell of her transport.
All she had left in her life was her purse and an overnight bag. Well, and a borrowed jacket and a vampire's arm around her shoulders. When she shivered, he pulled her in closer to his body. It felt good. Too good.
She had to be out of her mind. How did she go from mourning the loss of all that she had to once again kissing Griff Tyler like there was no tomorrow? As much as she'd like to blame it on a near-death experience, she couldn't. Terror may have sent her running into the night, but that didn't mean she should seek sanctuary in Griff's arms.
But that's exactly what she'd done and, what's more, she couldn't muster up either the energy or the desire to step away from him. Right now one of the yellow-coated firemen was looking in their direction, a chancellor, judging by the flash of fangs when he spoke to the fire chief. A second later he started toward them, his face grim, his dark eyes suspicious.
"Mr. Tyler, I'm Inspector Collins. I understand that you're the legal owner of this property even though Miss Bronson and her mother were the residents."
Griff nodded. "Actually, it belongs to my clan. As friends of the clan, the Bronsons were given use of the place years ago."
Friends of the clan? That was news to Keelie. Before she could say anything Griff gave her shoulder a slight squeeze. A warning? She casually stepped away, unwilling to let Griff control the conversation. Maybe the chancellor hadn't picked up on the silent communication, but Griff had read her message loud and clear.
Or maybe she was wrong about that. The investigator's eyes narrowed as he studied the two of them.
"Do either of you know of any reason that someone would burn down the house?"
Images of Griff's cousin Becan popped into her head, but once again he warded off anything she might have said. "No, we don't, Inspector."
The man clearly wasn't buying it. "How about you, Miss Bronson? Any problems with anyone? When you came home, did you notice anything out of the ordinary?"
"I've been gone since early yesterday. When I came home I had the strangest feeling I was being watched." She shivered again. "When I didn't see anyone, I went inside."
He nodded and then pointed toward the shipping container. "I take it you're moving?"
"Yes." She stared past him at the smoldering skeleton of the house. "I stayed in town after my mother's memorial service ended to meet with her attorney today. I found out that she left me a small trust fund. I plan to buy a place of my own, so I ordered the container and boxes to be delivered. I've only taken a short leave from work and needed to get started."
"Why don't you walk me through everything that happened from when you got home?"
"I decided to fix a sandwich and unwind a bit, so I went straight to the kitchen. An hour later, I couldn't put off facing my mother's room any longer. That's when I discovered her room had been vandalized."
She stopped talking as the memory swept her back to the pain of that moment.
"Everything was smashed or ripped to pieces. Everything."
Inspector Collins looked up from the notes he was taking. "Did you call the police?"
Keelie shook her head. "I decided to check out the rest of the house first, so I ran upstairs. I would've sensed if the intruder was still in the house, so I figured I wasn't in any immediate danger."
"And was the upstairs vandalized as well?"
"Yes, everything was trashed, but I didn't get much of a chance to look around before I heard glass breaking downstairs. By the time I got back to the first floor, the house was already filling up with smoke. It came from several directions. I dropped to the floor and crawled out the front door."
Griff had been leaning against the side of his transport. He straightened up and rejoined the discussion. "Wasn't the back door closer?"
"Yes, but the smoke was coming from the back and both sides of the house. The front was bad, too, but clearer than the rest of the lower floor." She had a sudden urge to cough, maybe to clear even the memory of smoke from her lungs.
The investigator nodded and then continued writing for several seconds. "What happened next?"
"I got outside and ran as far as the road before I stopped to look back. I never saw anyone around the house, but then it was after dark at that point."
"When did you arrive, Mr. Tyler?"
Despite the calm way he asked the question, Keelie frowned. She didn't like the barely veiled suspicion in the inspector's voice. She might have her own problems with Griff, but still she defended him.
"He pulled up right after it happened. As I said, last night was the memorial for my mother. He'd promised to stop by right after sunset to see if I needed anything."
"She was kneeling in the road when I drove up. I damn near hit her."
As he spoke, Griff reached out his arm to her again. He might only be trying to present a united front to the authorities, but she allowed herself to sink into his side. If nothing else, the warmth of his body helped keep the chill of the night air at bay. Not to mention she'd reached the breaking point after a day full of shocks.
"If you don't have any more questions, Inspector, I'm going to call a cab to take me to a hotel."
He held out a card to each of them. "Here's my contact information. I've got both of your numbers when I have more questions."
Interesting that he said "when" and not "if." Right now Keelie was too tired to do more than wonder about what he might be thinking. When the inspector was out of hearing, Keelie pulled out her phone. Griff placed his hand over hers before she could dial.
"I'll take you to a hotel if you insist, but I'd feel better if you came home with me."
"Why?"
"The security is better for one thing. The other is I never sleep well in hotels, and I'll be damned if I'll let you out of my sight before we get to the bottom of this." Maybe she was crazy. She had no reason to trust Griff, but she liked that he left the decision up to her. Well, except that he planned to be right beside her no matter what. But the truth was she was afraid, deeply afraid, to be alone right now.
"Fine, but let's be clear about one thing—I'm sleeping alone when we get there."
"It's a deal. I'll put your bag in my vehicle."
He pressed a quick kiss on her cheek and walked away, leaving her second-guessing her decision and wondering about the gleam of satisfaction she'd seen in his eyes.
## Chapter 8
Griff would kill the bastard that put the fear in Keelie's eyes. While dealing with the aftermath of the fire and all the questions, he'd kept a lid on his temper, but just barely. The last thing she needed to deal with right now was an enraged vampire intent on murder. But once he had her tucked safely away in his home, he'd start hunting for the culprit.
Becan better hope he had an ironclad alibi or he was a dead man. Griff glanced up at the sky and realized how late it was. The search would have to wait until tomorrow night. Right now he had more important things to do.
Like getting Keelie tucked up safely in his bed. Yeah, he'd promised she could decide where she slept. If she insisted on separate rooms, he'd live with it.
Griff carefully steered around the clutter of fire trucks and headed for his house on the Tyler clan estate. It wouldn't take long. As he drove, Keelie stared out at the darkness.
"I'm sorry this all happened."
"Did you torch the place?" she asked without looking at him.
A flash of hurt anger had his fangs running out. "Hell no."
Keelie finally turned in his direction, her own fangs gleaming whitely in the night. "Then you have nothing to be sorry for, do you? But, when I get my hands on the bastard who did, there'll be no quarter given. No matter who it was or what his last name is, blood will run."
He grinned. She was a bloodthirsty wench. He liked that about her. "Can I watch? Or help?"
"This isn't funny, Griff. Someone destroyed everything and for no reason."
He took her hand in his and kissed it. "No, it's not funny. I was smiling because you remind me of me. I was just thinking how much I was going to enjoying ripping the bastard into little bloody shreds."
"This is my battle, my duty."
He understood that as well. "And I'm on your side. Never doubt that."
As they drove through the security gates, he could feel her still watching him. She waited until he pulled into the garage before she finally responded.
"Just so you know, I do believe you."
Inside the house, Griff set the alarms and made a couple of quick calls. He had friends living on the outskirts of his estate whose special abilities made them well suited to the task of guarding his house in the daylight hours. They promised to come as soon as possible.
"Thank the pack for me."
When he hung up, Keelie was watching him, a curious look on her face. "The pack?"
He opened the fridge and pulled out sandwich makings for Keelie and a blood pack for himself. "It's, um, a nickname for a special security squad I use for daytime surveillance."
"What's special about them?"
"They're a canine team." True enough, except they worked with timber wolves, not dogs.
She accepted the sandwich he'd put together for her. "Thanks. I didn't realize how hungry I was."
He let her eat in peace, fixing her a second sandwich and then one for himself. After cleaning up the mess, he picked up her bag.
"Ready to go downstairs?"
An unexpected knock at the door had him dropping the bag and palming the gun he had tucked in his waistband. He motioned for Keelie to get back before he peeked outside. He jerked the door open and motioned for his friends to come inside.
"Keelie Bronson, meet Garrett and his partner Kipp. They'll be patrolling the estate while we sleep."
She started to smile but then she blinked and took a closer look at Kipp. "That's a timber wolf, and a big one at that."
Garrett grinned. "You've got a good eye. Most people just think he's a big dog, and an ugly one at that."
The wolf nipped at Garrett before shoving past him to lick Keelie's outstretched hand. Griff wasn't much for sharing, but that was the first real smile he'd seen on her face all day.
"He's not ugly. In fact—"
She pulled something out of her pocket. When she opened her hand, there was a small figurine of a wolf, one that was an exact match for Kipp.
"My mom and I collected these. We both love wolves." Her smile dimmed. "This is the only one that survived the destruction in my mother's room."
"Well, if you like wolves, you've come to the right place, Miss Bronson." Garrett shot a glance in Griff's direction. "Any time you want to spend time with a wolf, you just let me know."
Griff was going to wring his friend's neck for him. "Don't you have something better to do than stand around in my kitchen keeping me up? Or did you actually have a reason for being here?"
"We caught Becan's scent. He's definitely on the estate."
Keelie looked up from petting the wolf. "I get first crack at him."
The wolf woofed and Garrett laughed. "I think I'm in love."
Okay, enough was enough. "All right, you two, that's enough. Get going and find him. I'll catch up with you at dusk."
He shoved them out the door and threw the lock. At least the close-up encounter with the wolf had brightened Keelie's mood. Unfortunately watching her take such sensuous pleasure in running her fingers through Kipp's fur had him wanting to howl himself.
Time to go downstairs. Now, before he did something stupid like trying to coax Keelie into trying out the kitchen table. Despite his earlier plans, he knew she needed some rest. They both did. He'd offer her the guest room next to his bedroom, but that was as much distance as he could stand between them. He'd come too close to losing her, and he'd only just found her.
So tonight he'd sleep alone. But once the dust settled, all bets were off.
Keelie followed Griff down to the basement level that had no windows, no outside access to endanger him during the daylight hours. Maybe she should be thinking about something other than the way those jeans showed off that fine-looking backside of his, but she couldn't help herself. With her family history, she'd never expected to be attracted to a vampire, much less the very one rumored to have killed her father. Somehow, she knew there was more to the story than the few hints she'd managed to garner over the years.
Griff stopped halfway down the hall and opened a door. "This is your room. Mine is right next door. You should be able to find anything you need stocked in the bathroom."
When she started past him, he quickly backed away. His abrupt departure startled her and made her wonder at the reasons behind it. He'd certainly not been reluctant to touch her before this. She'd certainly expected at least another kiss. Maybe even hoped for another kiss or a reassuring hug.
Inside the bedroom, she set her purse on the dresser and got her first clear glimpse of how bad she looked. No wonder Griff hadn't wanted to kiss her. Her hair was a tangled mess, her skin and clothing covered in sooty streaks. She probably smelled as if she'd bathed in wood smoke and burned oil.
A knock at the bedroom door interrupted her pity party. She peeked out. "Yes?"
Griff shoved a stack of clothes at her. "I thought you might need something to sleep in."
She accepted the gift. "Thanks. I appreciate it."
Then he was gone again. The vampire was a constant surprise. More than ever, she needed to know his truth. But first things first. A hot bath was calling her name.
When Griff finished his shower, he could still hear Keelie moving around in the room next door. Images of her soaking in the oversized tub, her skin slick with soap, had him hard and hurting. He groaned and leaned his forehead against the cool tile. He hadn't been in this constant state of sexual arousal since his teens when he first became fascinated with the female half of the population.
The phone rang, providing him with a welcome distraction. A few seconds later he slammed the receiver down. Somehow Becan had managed to elude Garrett and his pack. The vampire's scent trail had ended abruptly when it crossed a road. Their best guess was someone had picked him up. None of the gates had opened, so he was still on the premises.
For now, they were pulling back to Griff's house to reinforce the security there. He trusted his friends to keep him and Keelie safe for the next few hours, but come nightfall he'd hunt. He needed to end this, to lay the past to rest, because for the first time the future held something he wanted.
Would she never settle down? Every move Keelie made jarred Griff awake. He flopped over onto his stomach and covered his head with a pillow. No good. His nerves were scraped raw with the need to charge next door and demand answers or, better yet, demand satisfaction. Whatever kind she was willing to give him.
An unexpected sound had him jerking upright in the darkness. He reached out with his vampire senses. Someone was sneaking around upstairs in the kitchen.
He rolled up to his feet, prepared to defend his home and his woman. After easing his door open, he moved through the darkness toward the soft glow of light at the top of the stairs. At the bottom of the steps, he sniffed the air. One kind of tension drained away only to be replaced by another as he realized who he was tracking—Keelie. Vampires were predators at heart, and she was rapidly becoming his favorite prey.
He deliberately made noise going up the steps to avoid startling her. Even so, with her chancellor hearing she'd probably been aware of his approach since he'd left his room. She was already pouring a second cup of hot chocolate when he walked into the room.
Her eyes were so damn sad. "Sorry if I woke you."
He wrapped his hands around the mug she offered him. The warmth felt good, but it also gave him something to do with his hands besides hauling Keelie straight into his arms.
Her wearing his oversized T-shirt and flannel boxers shouldn't have been sexy, but try telling his hormones that. He kept the counter between them to hide his body's response.
He said, "The real question is what is keeping you awake?"
She stared down into the depths of her mug for several seconds. Even from across the room he could see the ripples dancing in her drink.
"I almost died today, Griff." Her smile trembled almost as much as her hands. "And I don't even know why or what I did to make someone hate me that much."
"Keelie..." He started toward her, but she held up a hand to stop him.
"Griff, we both know that whatever is going on started the night my father died." Her fangs were showing now. "I want to know what really happened. I deserve that much."
Maybe she did, but he knew she'd hate the truth once she knew it. Before he could say another word, she picked up an envelope and tossed it down on the counter between them.
He blinked several times. "Is that your mother's letter? I assumed it burned up in the house."
"No, I've been carrying it with me since the night she died, trying to find the courage to read it."
He didn't blame her for feeling that way. She'd lost so much in the past few days, but running from the truth never worked for anyone. He had his own selfish reasons for wanting the facts to come out, but he'd lived with the lies so long now he didn't much care what the rest of the world thought. Only Keelie mattered right now, and he wanted no more lies between them.
He walked around the counter, needing to touch her, to ease the pain she was already feeling and the rest that would come the second they opened the envelope. To his surprise, she met him halfway, her hands sliding over his chest.
"Kiss me, Griff. Please."
Damn, he had no business taking advantage of her when her defenses were down, but he needed her touch as much as she needed his. He kissed her soft and slow, fighting against his instincts to take her right then and there, fast and hard, claiming her as his own. It didn't help his resolve when she moaned and practically climbed him, ending up with her legs wrapped around his hips, her core solidly against his erection.
This had to stop. Afterward, they could pick up where they'd left off if she could still stand his touch. No more lies.
"Keelie, honey, we have to stop." He gave her a tight hug first, hoping she'd know that he didn't want to let go of her even though it was the right thing to do.
She froze in his arms, leaning back enough to look him straight in the eye. "You don't want this?"
His laughter held little humor. "More than you can possibly know. I'm skirting the far edge of crazy wanting you."
He supported her with one arm while he snagged the envelope off the counter. "We'll deal with this first. Ignoring it won't make it go away."
Then he carried her downstairs to his bedroom. They needed someplace quiet and safe to deal with the storm that was coming the second she read her mother's letter. Granted, the living room upstairs would've been more neutral territory, but the wolves were at the door. Literally. And although their sense of smell was their strongest sense, there was nothing wrong with their hearing.
He set her on the bed and wrapped a blanket around her shoulders. After turning on enough light for her to read by, he sat down in the easy chair across the room, giving them both the space they needed.
"You read. I'll listen and then answer any questions that I can."
## Chapter 9
Keelie winced at the sudden brightness in the room and stared down at the envelope in her hands. As long as the light was soft and the shadows thick, she could hide her embarrassment and pretend she hadn't practically begged Griff Tyler for some hot sex. But evidently her best efforts had been all too easy to resist.
"I wanted it, too, Keelie. I still do. Never doubt that."
Her head jerked up. Was he some kind of mind reader? Feeling more than a bit defensive, she lied. "It was a mistake."
There was a lot of heat in those grass-green eyes when he smiled at her. "Only in the timing. Once we deal with that blasted letter, and you even hint that you still want what we started in the kitchen, I'm all yours."
She swallowed hard and tore open the envelope.
Keelie read the letter once and then a second time. Finally, she looked up from the paper that had just torn her world apart. "She killed my father? You helped my mother get away with murder?"
Griff was up and moving before she even finished talking. He knelt down in front of her, taking her hands in his. She didn't know why she let him.
"Your father was my best friend. He died way too young, and I miss him to this day. Your parents went through a rough patch, and Kenneth made a mistake. When he confessed to having a brief affair, your mother lashed out at him. As a human, he was no match for the strength of a chancellor. By the time I got there, he was dead, and she was hysterical. Lydia was terrified they'd take you away from her. If the court didn't buy that it was an accident, they could've even executed her, leaving you an orphan."
He threaded his fingers through hers. "We staged it to look as I was the one who killed your father. With my clan's influence, the court ruled it accidental death and ordered that I support your mother for the duration of her life. Looking back, maybe we could have handled things differently, better somehow. But once we set things in motion, there was no going back."
But that wasn't all of it. How much worse could it get?
"Over the years, your mother slowly twisted the truth in her own mind. Maybe it was the disease, but somehow she decided I really had killed your father. She tried to get the courts to review the case, using my own money to pay for an endless line of lawyers and petitions. For the past ten years, my own clan has suffered because of the constant financial drain. That's what Becan's using against me to try to take control of the family fortune. If he could prove I murdered your father, Becan would get it all, and then God help us all. No one will be safe, but especially anyone who isn't pureblooded vampire, starting with my friends you met earlier."
The wolves and their owners? Heartsick, she held out the letter. "Here's your proof for the courts so you can clear your name once and for all. And, Griff, I'll pay you back every penny, beginning with the trust fund Mom left me."
She looked around for a clock. "The lawyer's office should be open. I'll call them now and get things started."
For the first time, she saw Griff angry.
He rocked back on his heels, jerking his hands free from hers. "I don't need your damn money, Keelie. There are only two things I want, starting with keeping the people I care about safe."
His hands settled on her thighs, spreading them far enough apart enough for him to settle between them. The blatant move sent a jolt of heat bubbling through her body.
She suspected she knew what else he wanted, but she needed to hear the words. "And?"
He leaned in, crowding her. "And I want you. You okay with that?"
Where had the air in the room gone? She settled for nodding. As soon as she did, he tugged her down off the edge of the bed to straddle his thighs. His hand tangled in her hair, angling her mouth to mate with his.
And for the first time in days, maybe in forever, Keelie's life felt right.
Griff couldn't stand another second without getting skin-to-skin with Keelie. He'd always been in control. Not this time. He wasn't going to just pleasure her, he was going to claim her in every way he could think of. Take her every way he could, branding her with his touch, with his body.
As much as he loved kissing her, he needed more and soon, before he lost his mind completely. When he broke off contact, she pouted, her lips red and swollen. Oh, yeah, he wanted more of that, but not yet.
"The bed offers more possibilities," he told her as he tugged her flannel boxers down as far as he could before lifting her back up onto the mattress.
Then he peeled them the rest of the way off. Her scent taunted his control as her racing pulse had his fangs aching for a taste of her life's blood. Each thing in turn. He cupped her full breasts through the soft cotton of her shirt. She sighed and leaned back on her hands, a siren's smile on her face.
"I want you naked, Griff. Naked and up here with me."
Who was he to deny an invitation like that? He stood up and dropped his sweats. When his cock sprang free, she gasped in what he hoped was a combination of appreciation and anticipation.
"Ooh, let me get a good look," Keelie said.
Then she scooted to the far edge of the mattress just out of reach. That so wasn't happening. He crawled after her, a predator intent on claiming his mate. He caught her ankle and dragged her back to where he could take his time.
He captured her other ankle and lifted both high over his shoulders. He kissed the inside of her right thigh, grazing her soft skin with the sharp tips of his fangs. His woman clearly liked that. He repeated the maneuver with her left leg, leaving her moaning and him so hard he hurt.
Positioning himself to join his body with hers, he held back. "I've been waiting a long time to find my mate."
He rocked against her, testing and teasing them both. "This is a claiming, Keelie. Make no mistake about that."
He pressed even deeper. "Do you understand? Because I keep what's mine, Keelie, and you are mine."
Those caramel eyes were running hot as he thrust deep and hard. "I claim you, Griff Tyler. You're mine, too."
Then she held out her arms, pulling him close and arching her neck to the side, offering him everything she had to give. He pressed a kiss to her pulse point as the pounding rhythm of their hearts and bodies reached a crescendo. Then, as a blinding ecstasy burst over them, he sealed their connection by tasting the rich flow of her blood and then offering her his vein in return.
Griff shifted away from the woman sleeping curled up next to him, trying not to wake her. Neither of them had actually slept much, but he wasn't complaining. Their life together was definitely starting on a high note.
But there was still the problem of Becan and whoever had set fire to Keelie's house with her still in it. This time when his fangs ran out, it had nothing to do with sex and everything to do with vengeance and retribution.
He'd let Keelie sleep while he went on the hunt. He reached for his jeans and a clean shirt. Before he could get dressed, Keelie was up and heading for the bedroom door.
"Griff Tyler, don't think you can leave without me. It will only take me a minute to throw on some clothes."
He caught her arm. "I'd rather you stayed here where my friends can keep you safe. I hunt better alone."
"If we're mates, we're partners. Deal with it."
She punctuated her declaration with one of those long, hot kisses he'd already become addicted to.
"You don't fight fair." He kissed her again, almost giving into the temptation to head straight back to the bed.
But the distant pounding on the door upstairs put that idea on hold. Garrett wouldn't be disturbing them this long before sunset without good reason.
"Meet us in the kitchen."
Keelie nodded, and then she was off and running.
## Chapter 10
When she reached the kitchen, Griff was making coffee and talking to Garrett. Tension was definitely running hot in the room. Even the wolf was on full alert, his ruff standing at attention.
"What's happened?"
"They're pretty sure Becan's gone to ground some distance from here. We have to hurry if we want to get there before the sun sets, and he can take off again."
Were they forgetting what even the dying embers of the sun would do to Griff?
"But how can you go out in the daylight?"
"I'll ride in the trunk until we get there. By then, the sun will be down."
"Okay."
That might take care of one problem, but she knew facing a cornered vampire wouldn't be easy, even with backup. It was doubtful he'd come at them with just his fangs. But it was time this ended. For the sake of greed alone Becan had trashed her home, robbing her of the memories it had held.
A few minutes later, they all piled into the transport, Griff curled up and uncomfortable in the trunk. Keelie sat in the backseat with a pair of wolves while their handlers rode in the front with a pile of weapons. Evidently she wasn't the only one concerned about cornering a desperate vampire.
The ride took almost thirty minutes. When they drove the transport off the road and into a clump of trees, the top edge of the sun was just barely visible on the distant horizon. The instant it dropped out of sight, Griff popped the trunk and climbed out.
He did several stretches. "Remind me not to make a habit of traveling that way."
Garrett held out an assortment of firearms and a couple of knives. "Here you go, boss."
"Got any extras?" Keelie asked, surprising both men.
"Sure." Garrett offered her a pair of automatics. "Take your pick."
She chose the bigger of the two, checking it over with the ease of familiarity. All three men, and apparently even the two wolves, watched in amazement.
Garrett grinned. "I'm guessing that's not the first one of those you've held."
She gave them a smug smile. "Nope, and I've got the marksmanship medals to prove it."
Griff wasn't happy. "Just remember, targets don't shoot back. Aiming at another person isn't the same."
"I haven't shot anybody, but I've spent much of my professional life out in the wilderness. I've had to defend myself a time or two against varmints."
When one of the wolves growled, she added, "Most had two legs. The few that didn't, I aimed high. None of them were wolves."
When the wolf padded over for a head scratch, she laughed. "I swear, these two seem to actually understand every word I say."
Garrett grinned at her. "You have no idea."
Griff wedged himself between her and the wolf, giving the animal a dark look. "Back off, furball. She's mine. Now let's get going before Becan bolts again."
They fanned out and started forward, the wolves ranging ahead, their noses to the ground. Just over the next rise, Kipp stopped and tested the night breeze. When he growled low and deep in his chest, the other wolf joined in. Griff's two friends joined the animals, their eyes gleaming oddly in the moonlight.
What had they found? She inhaled deeply and knew the answer. The night air carried the scent of death.
Becan was dead. Griff knew it as well as he knew they were walking into a trap. The pungent smell of old blood and dead vampire made it impossible to pick up any other clues as to who was waiting up ahead. Using hand motions, he signaled for the pack members to circle around behind the cluster of boulders.
Keelie eased up next to him as they waited for the men to get in position. "Griff?"
"I'm guessing Becan isn't the one who burned the house down."
He looked down at her. If his suspicions were right, Keelie was in for another shock. "The night of the fire, you never realized anyone had been in the house until you actually saw the damage. Is that right?"
At first she seemed puzzled by his question, but she slowly nodded. "That's right. The scents were normal—Mom, me, and Dorothy."
Her eyes widened. "Dorothy? You think Dorothy burned the house down? Why would she do that?"
The woman in question answered herself. "I wanted to destroy everything Lydia held dear."
Dorothy strolled into sight behind Griff, a rifle pointed straight at Keelie. Cousin or not, she'd just signed her own death warrant. No one threatened Griff's mate and lived. No one.
Keelie's voice rang with pain. "But why? You and my mother were friends. You were family."
"No, actually I was your father's mistress. He promised to leave that bitch for me. Instead, she murdered him in cold blood and your lover covered it up. She never suspected who I was or what I'd meant to Kenneth."
"Why would you work for her all these years?"
"It's easier to poison someone when you cook her meals. I wanted her to suffer long and hard for what she took from me."
Keelie gasped. "She wasn't sick? That was your doing?"
Dorothy looked proud of herself. "It took me a long time to find the perfect poison, one that acted slow and mimicked a disease. No one ever suspected. At least right up until the end. I knew she'd hidden a letter for you. I couldn't risk anyone finding out, so I burned everything."
"The letter had nothing to do with you. And why kill Becan?"
As she spoke, Keelie shifted slightly farther away from Griff, making it harder for the other chancellor to watch them both at the same time. He mirrored her movements, putting even more distance between them.
Dorothy's lip curled back off her fangs, only emphasizing the crazed look in her eyes. "I proved to him once and for all which of us was the superior being. Of course, by the time he believed me, he was only a breath away from dead."
Griff's turn to keep the conversation going. "Okay, I understand why you'd go after him, but why me? Why Keelie?"
Her eyes flicked back and forth between the two of them. "I can't afford any loose ends. Griff, you've always been decent to me, so I'll make it fast and easy for you. But either way, you're going to die along with Keelie. A lover's quarrel, you know. Kind of funny, history repeating itself that way."
She brought the gun to bear directly on him, clearly thinking he was the bigger threat.
Keelie stepped toward the housekeeper, her own gun aimed at Dorothy and momentarily drawing her full attention. "Pull that trigger, Dorothy, and you're a dead woman. Walk away while you can."
"You don't have the guts to kill, Keelie. I do."
Just as she pulled the trigger, Griff charged forward, ignoring the burn of the bullet grazing his shoulder. Dorothy was so intent on taking another shot at him, that she missed the blacker-than-night body leaping through the air as Kipp latched onto her wrist and bit down.
Her scream echoed through the night. It only lasted long enough for Griff to finish the job his furry friend had started.
"Hold still."
"But that hurts."
"Most gunshots do."
Keelie pressed the last piece of tape in place. "I still think you should see a doctor."
"I'll heal."
She turned away, trying to hide the tears. She'd cried more in the last week than she had in her entire life. She was tired of it.
Griff caught her around her waist and pulled her down in his lap. Careful of his sore shoulder, she buried her face against his chest.
"I was terrified out there, Griff. For all of us."
He held her tight. "I know, but it's over now. We're safe now."
Yeah, she was. "I know."
But there was still something that needed saying. "Griffon Tyler, as the sole remaining representative of the Bronson family, it's my duty to make reparations for the trouble we've caused you."
Her lover jerked as if she'd hit him. "Damn it, Keelie, I've already told you I don't want your money."
She let her hands do a little wandering. "Yes, you made that perfectly clear. I was thinking of paying you back in some other way. I'll have to make installment payments. Lots of them."
His breathing picked up its pace, his pulse racing to keep up as her hand slid down between them.
"I'm sure we can work something out. Of course, you'll have to live here with me to keep up the payment schedule."
She adored the deep growl in his voice. "Only if you admit you love me as much as I love you."
"I'll even put it in writing. Tomorrow, though. Right now, I think we should work out the details."
The heat in his eyes had her wanting to purr. "I'm up for it if you are."
"Oh, rest assured, I am."
Then he set about proving it to her.
Don't miss the other spooky and sensual NOCTURNE BITES, available at www.ebooks.eharlequin.com and wherever eBooks are sold. Titles include:
The Huntress by Lisa Childs
Dragon Warrior by Meagan Hatfield
Firebreak by Anna Leonard
Halo Hunter by Michele Hauf
Prisoner of Temptation by Zandria Munson
Demon Kissed by Patti O'Shea
Marked by Lydia Parks
A Vampire's Mistress by Theresa Meyers
Hunter's Surrender by Anna Hackett
Vampire's Tango by Alexis Morgan
Her Dark Lord by Mel Teshco
Looking for more paranormal romance? The sizzling and spine-chilling books of Harlequin Nocturne are available at www.eHarlequin.com or your local bookstore.
Interested in writing for Nocturne Bites? Send your submission to NocturneBites@Harlequin.ca
ISBN: 978-1-4268-6528-2
A Vampire's Vindication
Copyright © 2010 by Patricia L. Pritchard
All rights reserved. Except for use in any review, the reproduction or utilization of this work in whole or in part in any form by any electronic, mechanical or other means, now known or hereafter invented, including xerography, photocopying and recording, or in any information storage or retrieval system, is forbidden without the written permission of the publisher, Harlequin Enterprises Limited, 225 Duncan Mill Road, Don Mills, Ontario, Canada M3B 3K9.
All rights reserved under International and Pan-American Copyright Conventions. By payment of the required fees, you have been granted the non-exclusive, non-transferable right to access and read the text of this e-book on-screen. No part of this text may be reproduced, transmitted, down-loaded, decompiled, reverse engineered, or stored in or introduced into any information storage and retrieval system, in any form or by any means, whether electronic or mechanical, now known or hereinafter invented, without the express written permission of publisher.
All characters in this book have no existence outside the imagination of the author and have no relation whatsoever to anyone bearing the same name or names. They are not even distantly inspired by any individual known or unknown to the author, and all incidents are pure invention.
This edition published by arrangement with Harlequin Books S.A.
® and ™ are trademarks of the publisher. Trademarks indicated with ® are registered in the United States Patent and Trademark Office, the Canadian Trade Marks Office and in other countries.
www.eHarlequin.com
| {
"pile_set_name": "Books3"
} |
-s 5
1
apple.bmp
1
1 1
| {
"pile_set_name": "Github"
} |
#export OVS_BRANCH=branch-2.11
#export OVS_VERSION=2.11
#export KERNEL_VERSION=4.15.0-54-generic
#export DISTRO=debian
#export GITHUB_SRC=https://github.com/openvswitch/ovs.git
#export DOCKER_REPO=openvswitch/ovs
# Example:
# make build
# make push
REPO = ${DOCKER_REPO}
tag = ${OVS_VERSION}_${DISTRO}_${KERNEL_VERSION}
build: ;docker build -t ${REPO}:${tag} --build-arg DISTRO=${DISTRO} \
--build-arg OVS_BRANCH=${OVS_BRANCH} \
--build-arg KERNEL_VERSION=${KERNEL_VERSION} \
--build-arg GITHUB_SRC=${GITHUB_SRC} -f ${DISTRO}/Dockerfile .
.PHONY: build
push: ;docker push ${REPO}:${tag}
| {
"pile_set_name": "Github"
} |
Histologic and ultrastructal studies of heart, lung, liver and kidney were made of mice treated with interleukin-2 singly and in combination with interleukin-1 and or interferon-alpha. The vascular leak syndrome induced by interleukin-2 was ameliorated by concomitent treatment with interleukin-1. This reduction in toxicity may be useful in the treatment of neoplasms with interleukin-2. | {
"pile_set_name": "NIH ExPorter"
} |
Pugsley Medal
The Pugsley Medal was created by Cornelius Amory Pugsley in 1928. The award honors champions of parks and conservation.
Responsibility for selecting the recipients has shifted from the American Scenic and Historic Preservation Society to the National Park Foundation, and most recently to the American Academy for Park and Recreation Administration. Until 1952 there was a gold, silver, and bronze award, and in 1953 it was switched to national, state, and local.
Pugsley Medal winners
1928 Stephen T. Mather, the first director of the National Park Service, gold medal
1928 Duncan McDuffie, silver medal
1929 Mary Williamson Averell, gold medal
1929 Nathaniel Lord Britton, silver medal
1931 Richard Lieber, gold medal
1932 Peter Norbeck, silver medal
1935 John Hayes McLaren, silver medal
1936 Robert Moses, gold medal
1937 J. Horace McFarland, gold medal
1938 Arno B. Cammerer, gold medal
1940 Newton B. Drury, silver medal
1942 Harold L. Ickes, gold medal
1942 Harlean James, bronze medal
1947 Conrad L. Wirth, gold medal
1947 Thomas J. Allen, silver medal
1948 Percival Proctor Baxter, gold medal
1949 Waldo Leland, gold medal
1950 Newton B. Drury, gold medal
1952 Harlean James, gold medal
1953 Frederick Law Olmsted, Jr., gold medal
1954 Harold C. Bryant, national award
1954 Russell Reid, silver award
1955 Loring McMillen, local award
1956 Gilbert Hovey Grosvenor, national award
1959 Alfred A. Knopf, national award
1962 Allen T. Edmunds, gold award
1962 Charles Alvin DeTurk, silver award
1962 Frank G. McInnis, bronze award
1963 Conrad L. Wirth, national award
1965 Harold P. Fabian, gold award
1965 U.W. Hella, silver award
1965 Daniel L. Flaherty, bronze award
1982 John A. Townsley,
1991 Denis P. Galvin, national award
2006 Bill Lane
See also
List of environmental awards
References
External links
Pugsley Medal Recipients 1928 – 1964
Winners of the Honorable Cornelius Amory Pugsley Awards, American Academy for Park and Recreation Administration
Category:Environmental awards
Category:American awards
Category:Awards established in 1928
Category:Parks in the United States
Category:1928 establishments in the United States | {
"pile_set_name": "Wikipedia (en)"
} |
Shannen, 46, shaved her head last year while in treatment, posting the process to Instagram via a series of poignant and heartbreaking photos.
Her friend, Anne-Marie Kortright, who was by Shannen's side throughout, said at the time: "I couldn't be prouder of you today. Your strength and courage is so inspiring and I am so very lucky to have you in my life.
"Thank you for blindly trusting me today to help you with such a big step. I will forever be there for you no matter what."
Shannen revealed her breast cancer diagnosis in 2015; in April this year, she revealed the disease was in remission.
In a poignant Instagram post, she told fans: "Moments. They happen. Today was and is a moment. What does remission mean? I heard that word and have no idea how to react. Good news? YES. Overwhelming. YES.
"Now more waiting. As every single one of my fellow cancer family knows, the next five years is crucial. Reoccurrences happen all the time. Many of you have shared that very story with me. So with a heart that is certainly lighter, I wait.
"In the meantime, decisions. Reconstruction which is several surgeries. Decision on taking a pill for the next five years that comes with its own set of problems and side effects. | {
"pile_set_name": "Pile-CC"
} |
Various types of conveyors have been utilized for conveying objects in industrial production lines. Objects may be conveyed from work station to work station individually or in groupings, depending on the object and the task to be performed. It may or may not be important to maintain any spacing or control of the objects during some or all of the travel. For example, apples being conveyed may simply be stacked randomly on a conveyor, while bottles being filled may be held rigidly in place by a filling machine that has received the bottles from a conveyor.
Certain conveyor belts (sometimes also called chains) are made of a plurality of interconnected links, driven by motors that engage the conveyor belt. Such conveying systems are commonly employed in the transportation of manufactured goods and articles, and for containers. With these typical systems, the motor drives a toothed drive sprocket that engages complimenting driving recesses or “dogs” formed on the conveyor belt. These drive units can be disposed in any number along the length of the conveyor belt. Such a drive unit and conveyor system is disclosed in U.S. Pat. No. 6,119,848 which is assigned to the assignee of the present invention, and is incorporated herein by reference in its entirety for all purposes.
Link type conveyor belts are sometimes designed having a knuckle/socket joint arrangement wherein one part of the link has a rounded knuckle and the opposite part has a socket formed by two extending edges. The knuckle of one link fits into the socket of a neighboring link. The knuckle is able to move in various directions within the socket, which allows for the conveyor system as a whole to curve and move.
The interconnected links typically have a platform member connected to or formed integral with the link's upper (conveying) surface. The platform member is generally shaped to match the neighboring platform members on other links such that the links can turn in a plane or twist while moving around curved sections of the conveying system, yet are also shaped such that the cracks and spaces formed between the links are minimized. The platform members can be connected to the links in several different ways. For instance, the platforms may have pegs extending therefrom which match corresponding slots on the links. Alternatively or additionally, the platforms can have snap springs which lock into place on corresponding sections of the links. Such a knuckle link with a platform surface member is disclosed in U.S. Pat. No. 6,209,716 which is owned by the assignee of the present invention and incorporated herein by reference in its entirety for all purposes.
In conventional endless loop conveyor systems, the conveyor belt (or chain) follows a path having a conveying section and a return section. In the conveying section the conveyor carries the conveyed objects from a process start point to a process finish point (depending on the application), and in the return section the conveyor returns from the finish point back to the start point. Thus, depending on the orientation of the conveyor, a substantial portion of the conveyor may not be used to actually convey objects at any given point in time. Accordingly, the cost of an endless conveyor per unit of active conveying section is increased due to the manner in which endless conveyors are conventionally configured and driven. The increased costs include original purchase, repair, maintenance, and/or installation costs for the length of the conveyor required along the return path.
Other conventional systems used to convey objects include “puck” systems, in which a freely moving puck carries a conveyed object along a conveyor. Pucks are often used to hold objects in a given orientation for a certain processing step. If the object is a container, the process may be filling, capping, etc. Guides along the sides of the conveyor may direct the puck along the direction of travel without leaving the conveyor. The puck may have movable parts for holding the object. The puck does not follow any track, but freely moves along a conveyor from station to station as desired. The puck may be gripped and/or aligned by a processing station (for example, a container filler) for a time, but the puck does not follow a defined track. Pucks can be problematical for various reasons. For example, because they are loose on a conveyor, pucks and their conveyed objects can be tipped over. Also, pucks may undesirably spin or move on a conveyor unless specifically guided since they do not follow any track. Further, different-sized pucks may be required if a line is to be converted from one object to another, which an be costly in terms of stocking and switching families of pucks. | {
"pile_set_name": "USPTO Backgrounds"
} |
cmake_minimum_required(VERSION 2.8)
project(libautomake-download NONE)
find_program(MAKE_EXE NAMES make)
include(ExternalProject)
ExternalProject_Add(project_libautomake
URL http://ftp.gnu.org/gnu/automake/automake-1.16.1.tar.gz
PREFIX ${CMAKE_CURRENT_BINARY_DIR}/build
CONFIGURE_COMMAND ${CMAKE_CURRENT_BINARY_DIR}/build/src/project_libautomake/configure --prefix=${OPEN_SRC_INSTALL_PREFIX}
BUILD_COMMAND ${MAKE_EXE} -j 4
BUILD_IN_SOURCE TRUE
INSTALL_COMMAND ${MAKE_EXE} install
TEST_COMMAND ""
)
| {
"pile_set_name": "Github"
} |
Chris Sale, Nelson Cruz must-plays in today's Daily Fantasy
Doug Fister, Nationals (vs. Phillies) – Fister has been very good in his last three starts, allowing a total of four runs in 19 2/3 innings, good for a 1.83 ERA. He faced the Phillies once before this season, picking up the win while surrendering two runs on four hits and five strikeouts in seven innings. His relative lack of strikeouts does limit his ceiling in a game such as this, but he’s projected for just 13 points, a total he can easily surpass against an offense as anemic as Philadelphia’s.
Jose Abreu, White Sox (vs. Twins, Logan Darnell) – Abreu extended his hitting streak to 20 games on Thursday with a 3-for-3 effort that included two doubles (he was also intentionally walked twice). The perfect night pushed Abreu’s slash line to .305/.356/.636 on the season. The White Sox’ slugger typically carries a four- or five-point projection, but today that is down to three. Take advantage of the low score.
Mike Trout, Angels (@ Rays, Jeremy Hellickson) – The primary reason for going with Trout on Friday is his four-point projection, one or two below his usual total. Any time you can get a stud like him at a lower price, you have to take it. Tampa Bay isn’t the best place for hitters, but that really doesn’t matter to a guy like Trout. He’s 1-for-2 with a double and a walk in his career against Hellickson. A word of warning, though, that Trout is just 7-for-39 in his last 10 games.
Other Recommendations
Pitchers
Chris Sale, White Sox (vs. Twins) – Sale’s 18-point projection is a bit prohibitive, but he’s too good to leave off this list whenever he pitches.
Sonny Gray, A’s (vs. Royals) – Gray has allowed four runs in his last 35 innings, a stretch covering five starts. He has 31 strikeouts in that same span.
Infielders
Adrian Beltre, Rangers (@ Indians, Danny Salazar) – Beltre is 6-for-16 with a home run, two doubles and four RBI in his last four games.
Victor Martinez, Tigers (vs. Rockies, Franklin Morales) – Martinez is 3-for-4 with a double, three RBI and a walk against Morales in his career.
Outfielders
Matt Kemp, Dodgers (vs. Cubs, Kyle Hendricks) – Kemp took an 0-for-2 on Thursday, but was 12-for-19 with three homers and eight RBI in his previous five games.
Nelson Cruz, Orioles (vs. Mariners, Roenis Elias) – Cruz has mashed lefties to the tune of .337/.444/.573 with five homers in 108 plate appearances this season. | {
"pile_set_name": "Pile-CC"
} |
[Zinc metabolism in duodenal ulcer].
Zinc concentrations were measured in blood and gastroduodenal mucosa of patients with duodenal ulcer in remission and exacerbation. These were found reduced in plasma but elevated in gastroduodenal mucosa. Healing of the ulcer lesion was associated with positive shifts in zinc metabolism which recovered normal values in ulcer remission. It is concluded that plasma and gastroduodenal levels of zinc reflect the stage of the pathological process in peptic ulcer. | {
"pile_set_name": "PubMed Abstracts"
} |
A growing body of evidence suggests that the widely used diabetes drug metformin can reduce the risk of cancer, researchers said Wednesday.
A study in mice exposed to tobacco carcinogens shows that the drug can reduce the development of lung tumors by more than 70%, and results from a small clinical trial in Japan suggest it can reduce rates of colorectal tumors in humans. The National Cancer Institute is now organizing a clinical trial to test the drug in people who smoke, and other trials are testing it against breast and prostate cancer.
There is not yet enough evidence to recommend using the drug routinely for cancer prevention, but the evidence is strong enough that physicians and patients considering drug therapy for type 2 diabetes might want to lean toward metformin because of its ancillary effects, researchers said in a news conference.
“Among the various treatment options for type 2 diabetes, if all other things are equal, early evidence that metformin might have benefit on the oncology side may play a role in decision-making,” said Dr. Michael Pollak, a medical oncologist at McGill University in Montreal who surveyed recent metformin research in an article in the journal Cancer Prevention Research.
The drug is particularly promising, he added, because unlike use of finasteride for preventing prostate cancer or tamoxifen for breast cancer, metformin appears to act across a broad spectrum of cancers.
Metformin increases the sensitivity of cells to insulin. It is one of the most widely used diabetes drugs, with 40 million prescriptions written in the United States in 2008.
It also has a number of other biological effects, including inhibiting a key signaling process between receptors in cells (called mammalian target of rapamycin, or mTOR) and reducing circulating levels of insulin and insulin-like growth factor. All those actions may inhibit or prevent the growth of cancer cells.
Interest in metformin was stimulated by a 2005 observational study in Britain that found that diabetics taking metformin had a 40% lower risk of cancer than those taking other diabetes drugs. Several subsequent studies have found the same thing.
“The epidemiologic evidence in diabetic humans is convincing and strong,” said Dr. Phillip A. Dennis, a medical oncologist at the National Cancer Institute. “It is real, and the reduction in risk ranges from 30% to 70%,” depending on the type of cancer, he said.
To learn more about it, Dennis and his colleagues used a well-known model of lung cancer, exposing mice to a carcinogen known as NNK, the most prominent carcinogen in tobacco smoke. All the mice given only NNK, and no metformin, developed lung cancer, the researchers reported Wednesday in Cancer Prevention Research.
But mice given metformin orally had a 33% reduction in numbers of tumors and a 34% reduction in tumor size. Those given it by injection had a 73% reduction in tumor number. The National Cancer Institute is now planning and seeking approval for a clinical trial in human smokers.
In another report in the Cancer Prevention Research journal, researchers from the Yokohama City University School of Medicine and the National Cancer Center Research Institute in Tokyo gave metformin to 12 nondiabetic patients with what are known as aberrant crypt foci, precursors of colorectal cancer.
After a month of low doses of the drug, the scientists found a significantly lower number of foci in the treated patients compared with 14 patients who did not receive the drug.
“These are very promising and exciting results,” said Dr. Scott Lippman, a medical oncologist at the University of Texas MD Anderson Cancer Center and editor of the journal.
In an editorial accompanying the reports, Dr. Jeffrey A. Engelman of Massachusetts General Hospital and Dr. Lewis C. Cantley of the Beth Israel Deaconess Medical Center in Boston also praised the findings. They noted that “primary care physicians and endocrinologists may consider this information when choosing an antidiabetes regimen for patients, especially those at a higher risk for developing cancer.”
In a news conference, Cantley noted that clinicians would have to rely for now on epidemiological studies because “prevention trials take forever to get done, and metformin is off patent, so no drug company will pay for them.”
Added Pollak of McGill University, “We don’t want to ignore the evidence we have now.”
thomas.maugh@latimes.com | {
"pile_set_name": "OpenWebText2"
} |
Intrathecal Administration of Losartan Reduces Directly Recorded Cardiac Sympathetic Nerve Activity in Ovine Heart Failure.
Early and preferential activation of cardiac sympathetic nerve activity (CSNA) is one of the strongest prognostic markers of heart failure (HF) in patients. Our previous studies have implicated central angiotensin mechanisms as playing a critical role in generating this increase in cardiac sympathetic drive. However, it is unclear if inhibition of AT1R (angiotensin type-1 receptors) in different neural groups in the sympathetic pathway to the heart, such as the sympathetic preganglionic neurons in the intermediolateral column of the spinal cord, can reduce cardiac sympathetic drive. We hypothesized that in HF, localized intrathecal administration of the AT1R antagonist losartan, specifically into the T1-2 subarachnoid space, would decrease CSNA. In normal conscious sheep, intrathecal infusion of Ang II (angiotensin II; 3.0 nmol/mL per hour), significantly increased mean arterial pressure and CSNA; this effect was abolished by prior administration of losartan (1 mg/h). In an ovine rapid ventricular pacing model of HF, the resting levels of heart rate and CSNA were significantly elevated compared with normals. Intrathecal infusion of losartan (1 mg/h) in HF significantly reduced CSNA and heart rate but did not change arterial pressure. The AT1R binding density in the spinal cord was also elevated in the HF group. Our data suggest that AT1Rs within the spinal cord are responsible, in part, for the increased CSNA in HF and may represent a target for the selective reduction of CSNA in HF. | {
"pile_set_name": "PubMed Abstracts"
} |
2016 Reading Borough Council election
The 2016 Reading Borough Council election took place on 5 May 2016 to elect members of Reading Borough Council in England. The election for Police and Crime Commissioner was held on the same day. The Labour Party increased their borough-wide vote by over 7% and held on to marginal seats in Church, Kentwood and Caversham, the latter receiving the highest number of votes recorded for any candidate at this election .
After the election, the composition of the council was:
Election result
Ward results
Abbey
Battle
Caversham
Church
Katesgrove
Kentwood
Mapledurham
Minster
Norcot
Park
Peppard
Redlands
Southcote
Thames
Tilehurst
Whitley
References
Category:2016 English local elections
2016
Category:2010s in Berkshire | {
"pile_set_name": "Wikipedia (en)"
} |
Molecular characterization and expression analysis of interferon-gamma in black seabream Acanthopagrus schlegelii.
Interferon gamma (IFN-γ) is a major component in immunological signaling and plays a key role in resisting viral infection. In this study, we identified and characterized an IFN-γ gene (AsIFN-γ) in the marine fish black seabream (Acanthopagrus schlegelii). We cloned AsIFN-γ genomic sequence, which comprises four exons, three introns and an upstream promoter including several conserved regulatory elements. The complete cDNA of AsIFN-γ was 816 bp in length and encoded a putative 194 amino acids (aa) protein with a 22 aa signal peptide, six α-helices and one nuclear localization signal (NLS). Multiple alignment showed that AsIFN-γ protein shared 31-60% identity with IFN-γ of other fish but low identity with fish IFN-γrel and IFN-γ of other vertebrates. AsIFN-γ was constitutively expressed in all examined tissues with the highest expression level in immune organs, such as spleen, gill and kidney. In black seabream infected by red spotted nervous necrosis virus (RGNNV), the expression of AsIFN-γ was significantly up-regulated in most tissues, and RGNNV infection in vitro also induced significant up-regulation of AsIFN-γ, indicating that AsIFN-γ was involved in immune response to RGNNV infection. Overexpression of AsIFN-γ in cultured Acanthopagrus schlegelii brain (AsB) cells rapidly and transiently stimulated the expression of JAK-STAT signaling pathway related genes including STAT1, STAT2 and IRF9, as well as the downstream antiviral genes MX1 and ISG15. Furthermore, overexpression of AsIFN-γ was able to significantly inhibit RGNNV replication and virus production in AsB cells. In summary, we identified a conserved IFN-γ gene of black seabream, and demonstrated the rapid and strong antiviral activities of AsIFN-γ against RGNNV in black seabream. | {
"pile_set_name": "PubMed Abstracts"
} |
MOTU Microbook Audio Interface Millsboro DE
The MicroBook gives users a complete personal recording solution for a Mac or PC laptop or desktop computer, with four simultaneous inputs for a microphone, a guitar, and a keyboard or other stereo line level device. The mic preamp delivers neutral coloration and pristine sound, with 20 dB pad and 48V phantom power for condenser mics. Programmable analog, digital, and headphone outputs provide flexible monitoring options.
MOTU Microbook Audio Interface
MOTU MICROBOOK AUDIO INTERFACE FITS IN YOUR POCKET
CAMBRIDGE, MA -- Tuesday, June 29, 2010. MOTU has announced the MicroBook, a USB bus-powered audio interface that delivers studio-grade audio performance in a compact size small enough to fit in your pocket. The MicroBook turns a Mac or PC computer into a personal 4x2 recording studio with all the audio I/O and mixing needed to make professional-quality recordings.
"The MicroBook is small in size but huge when it comes to audio quality," said Jim Cooper, MOTU Marketing Director. "Our tests show that it matches or exceeds the measured audio specifications of other so-called 'high-end' interfaces on the market that cost two and three times as much. So it's perfect for discriminating users who want quality I/O for on-the-go recording, personal studio tracking, laptop-based DJing, and many other applications."
Complete personal recording and playback
The MicroBook gives users a complete personal recording solution for a Mac or PC laptop or desktop computer, with four simultaneous inputs for a microphone, a guitar, and a keyboard or other stereo line level device. The mic preamp delivers neutral coloration and pristine sound, with 20 dB pad and 48V phantom power for condenser mics. Programmable analog, digital, and headphone outputs provide flexible monitoring options.
Superb audio quality
The MicroBook delivers uncompromising audio quality intended for the most demanding professional recording applications. Born from MOTU's award-winning line of FireWire, USB, and PCI audio interfaces, the MicroBook embodies decades of engineering expertise.
Other audio interface brands (even expensive ones) cut corners with unbalanced analog inputs and outputs, which can result in significantly compromised performance well below an equivalent balanced circuit. Not the MicroBook: its balanced inputs and outputs ensure the best-possible protection against RF interference, AC hum, and other noise-producing environmental factors.
Audio I/O
Due to its slim form factor, the MicroBook's mic input is a balanced quarter-inch jack. If a user would prefer to use a mic cable with an XLR plug, the MicroBook package includes an XLR-to-quarter-inch adapter. The mic input preamp and A/D converter deliver pristine sound and transparent coloration. True 48V phantom power can be enabled, powered by the MicroBook's USB connection to the computer.
The MicroBook's Precision Digital Trim™ feature provides digitally controlled analog trim on all analog inputs. This gives users the best of both worlds: the excellent signal quality of analog audio circuitry and the fine-tune precision of digital control. Users can even save and recall trim settings on their computer.
The guitar input provides the proper impedance loads for guitars, so users can play through guitar processing plug-ins in their host software with confidence, knowing that they are getting natural feel and response. To make host plu... | {
"pile_set_name": "Pile-CC"
} |
Vardø Airport, Svartnes
Vardø Airport, Svartnes (; ) is a short take-off and landing airport located at Svartnes in Vardø Municipality in Finnmark county, Norway. Owned and operated by the state-owned Avinor, it served 14,664 passengers in 2012. The airport has a runway aligned 15–33. It is served by Widerøe who operate Bombardier Dash 8 aircraft to Kirkenes and other communities in Finnmark. The airport is located from Vardøya and the town center of Vardø.
Svartnes was built by the German Luftwaffe 1943, where it served fighter aircraft to protect German convoys. The airport was abandoned in 1944 but reopened by the Norwegian Armed Forces for military passenger flights. Plans to start civilian operates were launched in the 1960s and from 1970 Norving started irregular flights to the airport. An upgrade to the terminal and runway were carried out between 1984 and 1990. Widerøe took over flights in 1991.
History
Svartnes was constructed by the Luftwaffe during the German occupation of Norway during World War II. The background for the establishment was Soviet attacks on supply convoys operating to Kirkenes. During construction, on 12 July 1943, eight Soviet Ilyushin Il-2s attacked Svartnes, but all were shot down. While the war remained in the area Soviet air attacks continued on the air base. The airport was completed in the fall of 1943, it was exclusively used for fighter aircraft detachments of Jagdgeschwader 5. These were used as part of the defense of German ship traffic around Varangerhalvøya. The original wooden runway was . The Wehrmacht operated a prisoner of war camp at the military base. The air base fell into disuse following the German evacuation in 1944.
The wooden runway was pillaged by locals to accumulate building materials for reconstruction. The Norwegian Armed Forces established itself in Vardø in the mid-1950s. The airport was renovated; a terminal was built consisting of two simple barracks, one used as a passenger terminal and the other as a tower, consisting of a glass addition on the roof. The gravel runway received portable runway lights. The Royal Norwegian Air Force served the airport with de Havilland Canada Twin Otter and Shorts Skyvan aircraft to transport military personnel.
The first plans for a civilian airport at Svartnes was launched by Varangfly, later renamed Norving, in 1964. Vardø was mentioned as one of five villages in Finnmark which the airline hoped to open with simple airfields which could serve air taxi and air ambulance flights. Two years later several major airlines proposed a network of short take-off and landing (STOL) airports in Northern Norway, and Vardø was proposed as a possible location. A county committee was established in 1966 to look into the matter. It considered seven locations in Finnmark, including Vardø and recommended in its report that planning continue. Simultaneously the Ministry of Transport and Communications was working on a plan for larger short take-off and landing airports. It decided that such airports will first be built in Helgeland, then Lofoten and Vesterålen and finally in Troms and Finnmark.
Norving started operating irregular air taxi flights to Vardø after they took delivery of an eight-seat Britten-Norman Islander in April 1970. In addition, the airline used the air field for air ambulance services. Norving received permission to operate a scheduled taxi route from Vardø to Kirkenes Airport, Høybuktmoen and Båtsfjord Airport from the late 1970s.
Construction of a new terminal and upgrading the airport to regional standard started in 1984. In February 1987 Vardø Municipality received operating permission from the government. The investments cost NOK 11.4 million, of which NOK 10 million was to be financed through a loan and the rest through subsidies from the government and the county. The latter was also responsible for covering the operating deficit. The upgraded airport opened on 6 April 1987. The first two months Norving continued its taxi route service to the airport, but from 1 June a regular concession scheduled service was introduced. Widerøe took over the services in 1991. At first the airport was served using Twin Otters, but from the mid-1990s the Dash 8 was introduced. From 1996, Svartnes and 25 other regional airports were taken over by the state and the Civil Aviation Administration (later renamed Avinor). Widerøe lost the bid to operate the services between 2000 and 2003 to Arctic Air, but resumed services in 2003. Airport security was introduced on 1 January 2005. There has several times been discuss whether to close down the airport, having in mind that Vadsø Airport is 67 km away by road. In 2002 there was political support in Stortinget to close it if the road was upgraded, but neither happened. In 2015 Avinor stated that closing Vardø would give least passenger trouble related to the financial support in the country, but that no decision on it would be made before 2019. Because of lack of available aircraft for purchase, before 2030 all short airports must be extended, closed or be flown with very small planes. Vardø has no room for extension.
Facilities
The airport has a single terminal building which has an integrated control tower. The passenger terminal has a capacity for thirty passengers per hour. The airport is located driving from the town center. Taxis are available at the airport. In 2012 the airport had 13,889 passengers, 2,518 aircraft movements and 0.7 tonnes of cargo handled.
Airlines and destinations
The airport is served by Widerøe with 39-seat Dash 8-100 aircraft connecting the community to Tromsø, Kirkenes and other communities in Finnmark. The routes are operated on public service obligation with the Ministry of Transport and Communications.
Accidents and incidents
On 5 March 1978 a Partenavia P.68 LN-MAD operated by Norving Airlines crashed at Falkefjell during approach to Vadsø Airport. The crew of two and a passenger all survived, but the aircraft was written off.
References
Bibliography
External links
Category:Airports in Finnmark
Category:Avinor airports
Category:Luftwaffe airports in Norway
Category:Royal Norwegian Air Force airfields
Category:Vardø
Category:1943 establishments in Norway
Category:Airports established in 1943
Category:Military installations in Finnmark | {
"pile_set_name": "Wikipedia (en)"
} |
Share this:
Police said the two gunmen were family members from the Palestinian village of Yatta in the Israeli-occupied West Bank.
Since the attack took place across a road from military headquarters, guards and soldiers were able to respond to the scene within minutes.
After the shooting, the Tel Aviv-Jaffa municipality issued a statement urging people to stay away from the scene.
Getty Images
Prime Minister Benjamin Netanyahu went directly to an emergency Defense Ministry meeting Wednesday upon his return from a trip to Russia, the Jerusalem Post reported.
In April, authorities moved to close down the Sarona market, which includes some 90 stores, amid fears that the commercial center was not sufficiently secure, but the site’s management said it would stay open.
Since last October, 29 Israelis and four others have been killed and hundreds more injured in terror attacks in Israel, although the violence had diminished in recent months.
About 200 Palestinians have also been killed, some two-thirds of them while carrying out attacks and the rest in clashes with troops, Israeli officials said. | {
"pile_set_name": "Pile-CC"
} |
‘No jobs without experience, no experience without jobs’: Young UK workers face Catch-22
To the frustration of young jobseekers nationwide, most employers say work experience is a critical factor when recruiting, yet 80 percent do not offer work experience programs to school students, a study has shown.
A survey of 18,000 UK
employers by the UK Commission for Employment and Skills found
that two-thirds of employers say they value work experience as
the highest factor when employing, compared with half who said
the same about academic qualifications.
Of the 80 percent who said they do not offer student placements,
one-fifth said “nothing could persuade” them to do so.
Despite the fall in youth unemployment from 22.5 percent in 2011
to 16.9 percent in 2014, young people are finding it harder than
ever to find jobs, partially due to the discrepancies between
employers expectations of candidates, and actions to help young
people secure work.
The report also shed light on the prevalence of nepotism and
privilege in the current employment market, with employers saying
that their favorite way to employ young workers is through
word-of-mouth and personal recommendations, meaning it is less
about “what” you know, and much more about
“who.”
“The whole thing is really a massive Catch 22,” said
Fiona Kendrick, chair and CEO of Nestlé UK and Ireland, who is a
UKCES commissioner.
She said employers and schools needed to communicate with one
another to establish links for students. Kendrick said one option
would be for big employers to create “hubs” with smaller
local companies to connect with schools and colleges.
“Smaller companies don’t have the resources, they don’t know
how to go about it, and many of them don’t know how to get
involved with the schools,” she added.
Students, the report found, are now less likely to be working
part-time or “small jobs” which have traditionally been seen as a
means of gaining work experience.
The proportion of students working alongside school has halved in
the past 25 years.
In 1990 more than 40 percent of 16 and 17 year olds had a
part-time job alongside their full-time education, whereas in
2014 the figure stood at less than 20 percent.
The report suggests this may be because students are put under
increasing pressure to focus on exams, or because advances in
technology mean the number of “small jobs,” such as
newspaper and milk deliveries, have been reduced.
A quarter of UK employers who did not offer work experience said
they had neither the time nor resources to create a position,
while 40 percent said there was no suitable vacancy.
It was further found there was a geographical discrepancy between
different areas. In Hull only 29 percent of employers offer work
experience, compared with 46 percent in Cheshire and London.
The government removed compulsory work experience for 14 to 16
year olds in 2012, with critics calling the move a
“retrograde step,” which made employers who care about
youth employment “sad and angry.” | {
"pile_set_name": "Pile-CC"
} |
ministrica rada Savezne vlade Njemačke, objavila je na službenim stranicama zadovoljstvo odlukom o ukidanju radnih dozvola za Hrvate te podatak da jeHrvata u posljednje dvije godine uselilo u Njemačku.
Dobili su radno boravišne dozvole, socijalno su osigurani i slobodni raditi u Njemačkoj. Njen je stav i ova objava umnogome utjecali na donošenje odluke Savezne vlade koja je istaknula zadovoljstvo dolaskom hrvatske radne snage u njihovu zemlju jer je riječ o kvalificiranim ljudima koji se uspješno integriraju u njemačko društvo
Brojka Hrvata koju Nijemci spominju snažno je odjeknula među Hrvatima u Njemačkoj i u nju nitko ne želi vjerovati. No, podaci nemilosrdno ukazuju na novi hrvatski egzodus.
Državni zavod za statistiku objavio je tablicu iseljenih i useljenih osoba iz Hrvatske za period od 2014. do 2014. godine te neto migraciju u promatranom razdoblju. Iz tablice je vidljivo da negativni trend počinje 2009. godine kad je u Hrvatsku uselilo 9.468 osoba, a i iz Hrvatske iselilo 9.940 Hrvata.
Zanimljiv je podatak DZS da je prošle godine u Hrvatsku uselilo 10. 638 osoba, a iz Hrvatske iselilo njih 20. 858.
Ali, dok hrvatska Vlada ne radi ništa kako bi spriječila taj egzodus, Nijemci se raduju dolasku Hrvata. Kako je istaknula ministrica Nahles, ovom odlukom će profitirati i Njemačka, ali i cijela Europska unija.
“Pravo slobodnog rada i gospodarskog djelovanja u nekoj drugoj zemlji članici Europske zajednice je jedna prednost neprocjenjive vrijednosti članstva Europske zajednice. Zahvaljujući olakšicama pri pristupanju tržištu rada, koje smo već zadnje dvije godine primijenjivali je danas već 93.000 Hrvatica i Hrvata u Njemačkoj zaposleno uz obavezno socijalno osiguranje , kao npr. u zdravstvu i socijalnim djelatnostima ili u prerađivačkom sektoru. To je Europa koja živi! A sa obaveznom minimalnom plaćom možemo konačno spriječiti damping plaća u slobodnom kretanju posloprimaca”, riječi su ministrice Nahles kojima je još jednom potvrdila uznemirujuće podatke o broju iseljenih Hrvata.
I još jednom pokazala da hrvatska Vlada laže, a Državni zavod za statistiku manipulira podacima za potrebe izborne kampanje SDP-a. | {
"pile_set_name": "OpenWebText2"
} |
10.09.28.02. 02 Provider Qualifications and Conditions for Participation.. A. A provider shall meet all conditions for participation as set forth in COMAR 10.09.36.03.. B. An ABA provider shall be licensed, certified, or otherwise legally authorized to provide ABA services in the jurisdiction in which the services are provided.C. An ABA provider may not have current sanctions or current disciplinary actions imposed by:. 1) The jurisdictional licensing or certification authority;.
10.09.28.03. 03 Participant Eligibility.. A. A participant shall meet the eligibility conditions set forth in §B of this regulation.. B. To qualify for ABA services, a participant shall:. 1) Be younger than 21 years old;. 2) Live in the community;. 3) Be diagnosed with an ASD by a qualified health care professional and referred for ABA services;. 4) Exhibit the presence of maladaptive behavior or developmental skills deficits that significantly interferes with home, school, or community activit
10.09.28.04. 04 Covered Services.. A. The Program covers the ABA services set forth in §B of this regulation when the services are:. 1) Medically necessary;. 2) Preauthorized by the Program or its designee; and. 3) Delivered in accordance with the participant’s treatment plan.. B. The Program covers the following ABA services:. 1) ABA assessment, which is a comprehensive behavior assessment that:. a) Is performed in person with a participant and the participant’s parent or caregiver by:.
10.09.28.05. 05 Limitations.. A. ABA services are only available to participants under the EPSDT program.. B. ABA services shall be delivered in a home or community setting, including a clinic, when medically necessary.C. The provider may not bill the Program for:. 1) Services that are:. a) Provided in:. i) A hospital;. ii) An institution for mental disease;. iii) An ICF-IID;. iv) A crisis residential program;. v) A residential treatment center;. | {
"pile_set_name": "Pile-CC"
} |
June 9, 2015
JUDGMENT
The Fourteenth Court of Appeals
HECTOR A. ESPINOZA AND ELIZABETH SANCHEZ, Appellants
NO. 14-14-00846-CV V.
OSIEL LOPEZ, Appellee
________________________________
This cause, an appeal from the judgment in favor of appellee, Osiel Lopez,
signed, July 18, 2014, was heard on the transcript of the record. We have inspected
the record and find the county court lacked jurisdiction over the case. We therefore
reverse the judgment of the court below and dismiss the case for want of
jurisdiction.
We further order that all costs incurred by reason of this appeal be paid by
appellee, Osiel Lopez.
We further order this decision certified below for observance.
| {
"pile_set_name": "FreeLaw"
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.