identifier stringlengths 11 32 | pdf_url stringlengths 17 4.62k ⌀ | lang stringclasses 120
values | error stringclasses 1
value | title stringlengths 2 500 ⌀ | source_name stringlengths 1 435 ⌀ | publication_year float64 1.9k 2.02k | license stringclasses 3
values | word_count int64 0 1.64M | text stringlengths 1 9.75M |
|---|---|---|---|---|---|---|---|---|---|
https://openalex.org/W2969759929 | https://www.mdpi.com/2072-4292/11/17/1978/pdf?version=1566473194 | English | null | Temporal Evolution of Corn Mass Production Based on Agro-Meteorological Modelling Controlled by Satellite Optical and SAR Images | Remote sensing | 2,019 | cc-by | 16,955 | Received: 11 June 2019; Accepted: 2 August 2019; Published: 22 August 2019 Received: 11 June 2019; Accepted: 2 August 2019; Published: 22 August 2019 Abstract: This work aims to provide daily estimates of the evolution of popcorn dry masses at
the field scale using an agro-meteorological model, named the simple algorith... |
https://openalex.org/W2089470281 | https://periodicos.ufes.br/geografares/article/download/154/80 | Portuguese | null | Ontologia do espaço e movimento de renovação crítica da Geografia: o desafio da diferença ontológica | Geografares/Geografares : Revista do Mestrado e do Departamento de Geografia, Centro de Ciências Humanas e Naturais, Universidade Federal do Espirito Santo | 2,009 | cc-by | 9,029 | I – ONTOLOGIA DO ESPAÇO E
MOVIMENTO DE RENOVAÇÃO
CRÍTICA DA GEOGRAFIA: SOBRE
A DETERMINAÇÃO SOCIAL DO
SER DO ESPAÇO. O objetivo do presente texto consiste em pro-
blematizar a reflexão ontológica sobre o espa-
ço no bojo do movimento de renovação crítica
que a geografia conheceu, notadamente, a par-
tir da década ... |
https://openalex.org/W3022368257 | https://hal.inrae.fr/hal-02941616/document | English | null | Co-benefits and Trade-Offs From Agro-Food System Redesign for Circularity: A Case Study With the FAN Agent-Based Model | Frontiers in sustainable food systems | 2,020 | cc-by | 13,130 | To cite this version: Hugo Fernandez-Mena, Graham K. Mac Donald, Sylvain Pellerin, Thomas Nesme. Co-benefits and
Trade-Offs From Agro-Food System Redesign for Circularity: A Case Study With the FAN Agent-
Based Model. Frontiers in Sustainable Food Systems, 2020, 4, pp.41. 10.3389/fsufs.2020.00041. hal-02941616 Dist... |
https://openalex.org/W2802220410 | https://ora.ox.ac.uk/objects/uuid:0256da7b-2f5d-45f9-ba33-03d53569f5af/files/mcf052ffd13e53457bc03a2e850ca2ed4 | English | null | Better governance, better access: practising responsible data sharing in the METADAC governance infrastructure | Human genomics | 2,018 | cc-by | 10,668 | Murtagh et al. Human Genomics (2018) 12:24
https://doi.org/10.1186/s40246-018-0154-6 Murtagh et al. Human Genomics (2018) 12:24
https://doi.org/10.1186/s40246-018-0154-6 Open Access Better governance, better access: practising
responsible data sharing in the METADAC
governance infrastructure Madeleine J. Murtagh1... |
https://openalex.org/W4285059537 | https://www.epj-conferences.org/10.1051/epjconf/202226401009/pdf | English | null | Two-wavelength digital holographic interferometry for unambiguous range extended measurements in fluid mechanics | EPJ web of conferences | 2,022 | cc-by | 5,206 | 1 Introduction mechanical systems (MEMS) fabrication, ultraprecise
manufacture, research in ophthalmology etc. [2] For fast occurring phenomena, where the nature and
properties of the fluid must be studied without
disturbances from the observer, non-contact optical
methods such as digital holographic interferometry... |
https://openalex.org/W2314805453 | https://revistas.uepg.br/index.php/uniletras/article/download/673/1289/4832 | Portuguese | null | ROMANCEIRO DA INCONFIDENCIA: PODER E LITERATURA | Uniletras | 2,009 | cc-by | 7,288 | Romanceiro da Indonfi dência: power and
literature Prof. Dr. Celso Leopoldo Pagnan
* Resumo: Este artigo tem como objetivo principal analisar o livro Romanceiro da Inconfi dência,
de Cecília Meireles, sob duas perspectivas, a literária e a jurídica. Isso porque a obra, para além de
retomar literariamente um episódio d... |
https://openalex.org/W3119949431 | https://bmcoralhealth.biomedcentral.com/track/pdf/10.1186/s12903-020-01375-1 | English | null | Selected salivary parameters in children with idiopathic nephrotic syndrome: a preliminary study | BMC oral health | 2,021 | cc-by | 8,314 | Abstract Background: Disturbances in the levels of serum constituents occurring in chronic renal diseases can be reflected in
the saliva composition. The aim of this study was to assess some selected salivary components in children suffering
from idiopathic steroid-sensitive nephrotic syndrome (iNS). Methods: A cas... |
W4385550032.txt | https://jnanobiotechnology.biomedcentral.com/counter/pdf/10.1186/s12951-023-02009-8 | en | Correction: Detection of β-amyloid aggregates/plaques in 5xFAD mice by labelled native PLGA nanoparticles: implication in the diagnosis of Alzheimer’s disease | Journal of nanobiotechnology | 2,023 | cc-by | 359 | Govindarajan and Kar Journal of Nanobiotechnology
https://doi.org/10.1186/s12951-023-02009-8
Journal of Nanobiotechnology
(2023) 21:251
Open Access
CO R R E C T I O N
Correction: Detection of β-amyloid
aggregates/plaques in 5xFAD mice by labelled
native PLGA nanoparticles: implication in the
diagnosis of Alzheimer... | |
https://openalex.org/W1966723896 | https://bmccancer.biomedcentral.com/counter/pdf/10.1186/1471-2407-14-788 | English | null | Obesity is a significant risk factor for breast cancer in Arab women | BMC cancer | 2,014 | cc-by | 6,651 | RESEARCH ARTICLE Open Access * Correspondence: nelkum@hotmail.com
1Division of Clinical Epidemiology, Sidra Medical and Research Centre, Doha,
Qatar
4Department of Biostatistics, Epidemiology, and Scientific Computing,
KFSH&RC, MBC#03, KSA, Riyadh, Saudi Arabia
Full list of author information is available at the end of... |
https://openalex.org/W2913182623 | https://www.redalyc.org/journal/5704/570463757017/570463757017.pdf | Portuguese | null | An integrative review of the methods used for cortisol assessment in clinical studies investigating the association between Blood Pressure and Cortisol Hormone | Revista de Epidemiologia e Controle de Infecção | 2,019 | cc-by | 9,147 | RESUMO Justificativa e Objetivos: A Hipertensão Arterial Sistêmica (HAS) é uma condição de saúde que representa um problema de saúde públi-
ca mundial e sua relação com o hormônio cortisol ainda não está amplamente esclarecida. Dessa forma, esse estudo teve como objetivo
identificar na literatura, as circunstâncias de... |
https://openalex.org/W4297979925 | https://dash.harvard.edu/bitstream/1/33029912/1/5404611.pdf | English | null | Genetic effects influencing risk for major depressive disorder in China and Europe | Carolina Digital Repository (University of North Carolina at Chapel Hill) | 2,017 | cc-by | 9,799 | Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available
under the terms and conditions applicable to Other Posted Material, as set forth at http://
nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of-use#LAA Permanent link http://nrs.harvard.edu/urn-3:HUL.InstRep... |
https://openalex.org/W4296010615 | https://journal.ipb.ac.id/index.php/jpsl/article/download/40715/24046 | English | null | Wetland Fires in Community Perspectives | Jurnal pengelolaan sumberdaya alam dan lingkungan | 2,022 | cc-by | 4,381 | Journal of Natural Resources and Environmental Management
12(3): 466-471. http://dx.doi.org/10.29244/jpsl.12.3.466-471
E-ISSN: 2460-5824
http://journal.ipb.ac.id/index.php/jpsl Journal of Natural Resources and Environmental Management
12(3): 466-471. http://dx.doi.org/10.29244/jpsl.12.3.466-471
E-ISSN: 2460-5824
... |
https://openalex.org/W4376620544 | https://jurnal.stmikroyal.ac.id/index.php/jurdimas/article/download/1966/pdf | Indonesian | null | Pelatihan Pembuatan Laporan Keuangan Bagi Kelompok Pembudidaya Ikan Mina Lestari | Jurnal Pengabdian Kepada Masyarakat Royal | 2,023 | cc-by-sa | 2,934 | Jurdimas (Jurnal Pengabdian Kepada Masyarakat) Royal
Vol. 6 No. 2, April 2023, hlm. 295 - 300
ISSN
DOI: https://doi.org/ 10.33330/jurdimas.v6i2.1966
ISSN
Available online at https://jurnal.stmikroyal.ac.id/index.php/jurdimas Jurdimas (Jurnal Pengabdian Kepada Masyarakat) Royal
Vol. 6 No. 2, April 2023, hlm... |
https://openalex.org/W4293758605 | https://www.shs-conferences.org/10.1051/shsconf/202214501028/pdf | English | null | Research on the improvement of engineering college students’ artistic accomplishment under the new engineering background | SHS web of conferences | 2,022 | cc-by | 2,524 | 1 The connotation of new engineering New engineering is a higher education reform plan with Chinese characteristics in
response to the global situation, the development situation of domestic engineering
education and the service of national strategy. New engineering mainly includes three
aspects: first, the transfor... |
https://openalex.org/W2730138546 | https://researchonline.gcu.ac.uk/files/25096062/Are_HIV_Smartphone_APPS_Online_Int_Fit_for_Purpose.pdf | English | null | Are HIV Smartphone Apps and Online Interventions Fit for Purpose? | null | 2,017 | cc-by | 11,323 | re HIV smartphone apps and online interventions fit for purpose? Are HIV smartphone apps and online interventions fit for purpose? Singh, Aneesha; Gibbs, Jo; Estcourt, Claudia; Sonnerberg, Pam; Blandford, An Published in:
Proceedings of the 2017 International Conference on Digital Health Published in:
Proceedings of th... |
https://openalex.org/W4361849889 | https://figshare.com/articles/journal_contribution/Supplementary_Table_S9_from_PDGF_Engages_an_E2F-USP1_Signaling_Pathway_to_Support_ID2-Mediated_Survival_of_Proneural_Glioma_Cells/22408352/1/files/39854228.pdf | English | null | Supplementary Table S5 from PDGF Engages an E2F-USP1 Signaling Pathway to Support ID2-Mediated Survival of Proneural Glioma Cells | null | 2,023 | cc-by | 99 | Supplementary Table 9. Primers used for genotyping
Gene/Transgene
Sequence (5'-3')
Id2fl/fl Genotyping F
TAGGCATGAAGGGGCTTGTA
Id2fl/fl Genotyping R
GCCACTGGGCTCATAAAAGT
Id2fl/fl Deletion Specific F
CACCTACACTGAAGGGCACA
Id2fl/fl Deletion Specific R
AGTCAGCCACACTTGGTCCT
GFAP-tTa F
TCGCTTTCCTCTGAACGCTTCTCG
GFAP-tTa R
TCTG... |
https://openalex.org/W3130569119 | https://www.medrxiv.org/content/medrxiv/early/2021/02/23/2021.02.19.21251232.full.pdf | English | null | Deep neural network estimated electrocardiographic-age as a mortality predictor | medRxiv (Cold Spring Harbor Laboratory) | 2,021 | cc-by | 16,264 | Deep neural network estimated electrocardiographic-age as a mortality predictor Emilly M Lima, MSc1,2 *; Antônio H Ribeiro, PhD3,4 *; Gabriela MM Paixão, MD, MSc1,2,* ; Manoel
Horta Ribeiro5; Marcelo M Pinto Filho, MD, PhD1,2; Paulo R Gomes, MSc1,2; Derick M Oliveira,
MSc3; Ester C Sabino, MD, PhD6; Bruce B Duncan, M... |
W4366827193.txt | https://www.mdpi.com/2223-7747/12/9/1736/pdf?version=1682212223 | en | Strategies for Engineering Virus Resistance in Potato | Plants | 2,023 | cc-by | 9,602 | plants
Review
Strategies for Engineering Virus Resistance in Potato
Jiecai Liu 1,† , Jianying Yue 1,† , Haijuan Wang 1 , Lingtai Xie 1 , Yuanzheng Zhao 2 , Mingmin Zhao 1, *
and Hongyou Zhou 1, *
1
2
*
†
College of Horticulture and Plant Protection, Inner Mongolia Agricultural University, Hohhot 010018, China
Inner ... | |
https://openalex.org/W2062866783 | https://projecteuclid.org/journals/journal-of-applied-mathematics/volume-2014/issue-none/Growth-Theorems-for-a-Subclass-of-Strongly-Spirallike-Functions/10.1155/2014/608641.pdf | Latin | null | Growth Theorems for a Subclass of Strongly Spirallike Functions | Journal of applied mathematics | 2,014 | cc-by | 5,819 | 1. Introduction growth and covering theorems for normalized biholomor-
phic convex functions on the unit disk and also obtained
the growth and covering theorems for normalized biholo-
morphic starlike functions on the unit disk by Alexander’s
theorem. Liu and Ren [6] obtained the growth theorems
for starlike mappings o... |
https://openalex.org/W4240122979 | https://scholarship.claremont.edu/cgi/viewcontent.cgi?article=1733&context=aliso | English | null | Back Matter 7 (4) | Aliso | 1,972 | cc-by | 21,897 | eco
e ded C tat o
eco
e ded C tat o
(1972) "Back Matter 7 (4)," Aliso: A Journal of Systematic and Floristic Botany: Vol. 7: Iss. 4, Article 9.
Available at: https://scholarship.claremont.edu/aliso/vol7/iss4/9 Back Matter 7 (4)
Back Matter 7 (4) Follow this and additional works at: https://scholarship.claremont.edu/a... |
https://openalex.org/W3181683803 | https://ojmo.centre-mersenne.org/item/10.5802/ojmo.14.pdf | English | null | Screening for a Reweighted Penalized Conditional Gradient Method | Open journal of mathematical optimization | 2,022 | cc-by | 22,948 | creening for a Reweighted Penalized Conditional Gradient Metho Yifan Sun
Stonybrook University - Department of Computer Science, Stonybrook, New York, USA
yifan.sun@stonybrook.edu Yifan Sun
Stonybrook University - Department of Computer Science, Stonybrook, New York, USA
yifan.sun@stonybrook.edu Francis Bach
INRIA - Dé... |
https://openalex.org/W2766822528 | https://www.int-arch-photogramm-remote-sens-spatial-inf-sci.net/XLII-3-W3/81/2017/isprs-archives-XLII-3-W3-81-2017.pdf | English | null | MEASURING LEAF WATER CONTENT USING MULTISPECTRAL TERRESTRIAL LASER SCANNING | The international archives of the photogrammetry, remote sensing and spatial information sciences/International archives of the photogrammetry, remote sensing and spatial information sciences | 2,017 | cc-by | 3,997 | 1.
INTRODUCTION wavelengths which can be used to estimate LWC remotely
(Ceccato et al., 2001). The estimation of LWC in terms of
equivalent water thickness (EWT, the ratio of the weight of
water and leaf area) and drought has been recently studied using
single wavelength terrestrial laser scanning (TLS) and
multis... |
https://openalex.org/W4297180195 | https://vbn.aau.dk/ws/files/522175228/1_s2.0_S0956713522005758_main.pdf | English | null | Effects of grade, smiley, and text on Danish and Finnish consumers’ perceptions of food safety inspection reports | Food control | 2,023 | cc-by | 9,319 | Aalborg Universitet Effects of grade, smiley, and text on Danish and Finnish consumers’ perceptions of food
safety inspection reports Effects of grade, smiley, and text on Danish and Finnish consumers’ perceptions of food
safety inspection reports Vainio, Annukka ; Ollila, Sari ; Sørensen, Thomas Alrik; Kaskela, Jenni ... |
https://openalex.org/W4234362902 | https://kclpure.kcl.ac.uk/ws/files/3353430/journal.pone.0034188.pdf | English | null | Culture and End of Life Care: A Scoping Exercise in Seven European Countries | Routledge eBooks | 2,020 | cc-by | 20,114 | Citation for published version (APA):
Gysels, M., Evans, N., Menaca, A., Andrew, E., Toscani, F., Finetti, S., Pasman, H. R., Higginson, I., Harding,
R., Pool, R., & Project PRISMA (2012). Culture and End of Life Care: A Scoping Exercise in Seven European
Countries. PL o S One , 7(4), -. Article e34188. https://doi.org... |
https://openalex.org/W4309319889 | https://www.glossa-journal.org/article/id/9367/download/pdf/ | English | null | On the feature (in)deficiency of dedicated impersonal pronouns: the view from Jordanian Arabic | Glossa | 2,022 | cc-by | 15,594 | Alhailawani, Mohammad & Othman, Waleed & Abdel-Ghafer, Osama.
2022. On the feature (in)deficiency of dedicated impersonal pronouns:
The view from Jordanian Arabic. Glossa: a journal of general linguistics
7(1). pp. 1–34. DOI: https://doi.org/10.16995/glossa.9367 On the feature (in)deficiency of dedicated
impersonal... |
https://openalex.org/W2621454852 | https://escholarship.org/content/qt51j2b643/qt51j2b643.pdf?t=owjcot | English | null | Fluorescent tagged episomals for stoichiometric induced pluripotent stem cell reprogramming | Stem cell research & therapy | 2,017 | cc-by | 6,543 | UCSF
UC San Francisco Previously Published Works
Title
Fluorescent tagged episomals for stoichiometric induced pluripotent stem cell
reprogramming
Permalink
https://escholarship.org/uc/item/51j2b643
Journal
Stem Cell Research & Therapy, 8(1)
ISSN
1757-6512
Authors
Schmitt, Christopher E
Morales, Blanca M
Schmitz, Elle... |
https://openalex.org/W4214923002 | https://www.scielo.br/j/edur/a/MRBhfLcyM9ZVBhMvMMvNhTN/?lang=pt&format=pdf | Portuguese | null | PARQUE TEMÁTICO, POPULARIZAÇÃO E PESQUISA AMAZÔNICA: A PROPOSTA DO BOSQUE DA CIÊNCIA/INPA | Educação em Revista | 2,022 | cc-by | 14,579 | SAULO CÉZAR SEIFFERT SANTOS1
ORCID: https://orcid.org/0000-0001-7890-1886 MÁRCIA BORIN DA CUNHA2
ORCID: https://orcid.org/0000-0002-3953-5198 RESUMO: Os parques temáticos são espaços de entretenimento e de aprendizagem científico-cultural
por meio das atividades educativas. Nos estados que compõem a Amazônia brasile... |
https://openalex.org/W3203998766 | https://aclanthology.org/2021.inlg-1.20.pdf | English | null | Single Example Can Improve Zero-Shot Data Generation | null | 2,021 | cc-by | 7,653 | 1
Introduction Training dialogue systems used by virtual assis-
tants in task-oriented applications requires large
annotated datasets. The core machine learning task
to every dialogue system is intent detection, which
aims to detect what the intention of the user is. New
intents emerge when new applications, supported
... |
https://openalex.org/W2013537480 | https://ora.ox.ac.uk/objects/uuid:e4b3b3a3-66dc-4534-aad8-68f0f4baaed6/download_file?safe_filename=journal.pone.0032555.pdf&file_format=application%2Fpdf&type_of_work=Journal+article | English | null | Structural Stability of Human Protein Tyrosine Phosphatase ρ Catalytic Domain: Effect of Point Mutations | PloS one | 2,012 | cc-by | 10,103 | Abstract Competing Interests: The authors have declared that no competing interests exist. Competing Interests: The authors have declared that no competing interests exist. * E-mail: roberta.chiaraluce@uniroma1.it * E-mail: roberta.chiaraluce@uniroma1.it . These authors contributed equally to this work. Structural Stab... |
https://openalex.org/W2866185521 | http://dspace.vutbr.cz/bitstream/11012/137171/4/Venclovsky__2018_IOP_Conf._Ser.__Mater._Sci._Eng._383_012033.pdf | English | null | Stochastic optimization of reinforced concrete elements’ design | IOP conference series. Materials science and engineering | 2,018 | cc-by | 4,276 | Stochastic optimization of reinforced concrete
elements’ design To cite this article: J Venclovský* et al 2018 IOP Conf. Ser.: Mater. Sci. Eng. 383 012033 View the article online for updates and enhancements. This content was downloaded from IP address 147.229.6.155 on 06/12/2018 at 12:02 IOP Conference Series: Materia... |
https://openalex.org/W3150541371 | https://bmcgenomics.biomedcentral.com/track/pdf/10.1186/s12864-021-07562-w | English | null | Evolutionary research on the expansin protein family during the plant transition to land provides new insights into the development of Tartary buckwheat fruit | BMC genomics | 2,021 | cc-by | 12,502 | Sun et al. BMC Genomics (2021) 22:252
https://doi.org/10.1186/s12864-021-07562-w Sun et al. BMC Genomics (2021) 22:252
https://doi.org/10.1186/s12864-021-07562-w Open Access © The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License,
wh... |
https://openalex.org/W3200041105 | https://www.frontiersin.org/articles/10.3389/fpsyg.2021.645266/pdf | English | null | Explaining Variation in Parents' and Their Children's Stress During COVID-19 Lockdowns | Frontiers in psychology | 2,021 | cc-by | 14,593 | Explaining Variation in Parents’ and
Their Children’s Stress During
COVID-19 Lockdowns Theo Toppe 1*†, Roman Stengelin 1,2†, Louisa S. Schmidt 3, Naiera Amini 3 and
Nils Schuhmacher 4 1 Department of Comparative Cultural Psychology, Max Planck Institute for Evolutionary Anthropology, Leipzig, Germany,
2 Leipzig Researc... |
https://openalex.org/W3200762904 | https://dspace.mit.edu/bitstream/1721.1/141441/2/s41467-021-25705-1.pdf | English | null | Evidence of two-dimensional flat band at the surface of antiferromagnetic kagome metal FeSn | Nature communications | 2,021 | cc-by | 12,993 | MIT Open Access Articles
Evidence of two-dimensional flat band at the
surface of antiferromagnetic kagome metal FeSn
The MIT Faculty has made this article openly available. Please share
how this access benefits you. Your story matters.
tation: Han, Minyong, Inoue, Hisashi, Fang, Shiang, John, Caolan, Ye, Linda et al. ... |
https://openalex.org/W3007246627 | https://rgu-repository.worktribe.com/preview/2014795/RABAH%202020%20Heterogeneous%20parallelization%20%28VOR%29.pdf | English | null | Heterogeneous Parallelization for Object Detection and Tracking in UAVs | IEEE access | 2,020 | cc-by | 8,240 | Received February 7, 2020, accepted February 19, 2020, date of publication February 28, 2020, date of current version March 11, 2020. Digital Object Identifier 10.1109/ACCESS.2020.2977120 INDEX TERMS CNN, object detection, object tracking, Gain-Scheduled PID, quadcopter. INDEX TERMS CNN, object detection, object tracki... |
https://openalex.org/W2797659889 | https://europepmc.org/articles/pmc5922351?pdf=render | English | null | BET inhibition is an effective approach against KRAS-driven PDAC and NSCLC | Oncotarget | 2,018 | cc-by | 8,226 | BET inhibition is an effective approach against KRAS-driven
PDAC and NSCLC
p Toni Jauset1,2,3, Daniel Massó-Vallés1,2, Sandra Martínez-Martín1,2, Marie-Eve
Beaulieu1,3, Laia Foradada1,3, Francesco Paolo Fiorentino4,5, Jun Yokota6, Bernard
Haendler7, Stephan Siegel7, Jonathan R. Whitfield1 and Laura Soucek1,2,3,8
1Va... |
https://openalex.org/W1975025884 | https://europepmc.org/articles/pmc4061208?pdf=render | English | null | High dosage of agmatine alleviates pentylenetetrazole-induced chronic seizures in rats possibly by exerting an anticonvulsive effect | Experimental and Therapeutic Medicine | 2,014 | cc-by | 4,434 | Introduction Agmatine is an endogenous amine synthesized via the decar
boxylation of L‑arginine mediated by arginine decarboxylase. Agmatine is expressed in a variety of animal organs, particu
larly the brain, where it acts as a novel neurotransmitter or
neuromodulator (1).i Although the specific physiological actio... |
https://openalex.org/W4385366363 | https://djm.uodiyala.edu.iq/index.php/djm/article/download/993/798 | Arabic | null | Risk Factors for Colonization with S.aureus and Methicillin Resistant Staphylococcus aureus Among Health Care Workers in Al-Batool teaching hospital for maternity and children in Diyala, Iraq | Maǧallaẗ Diyālá al-ṭibbiyyaẗ/Maǧallaẗ diyālá al-ṭibbiyyaẗ | 2,023 | cc-by | 11,342 | ORIGINAL RESEARCH
Published: 30 June 2023
Doi: 10.26505/DJM.24026850816 Diyala Journal of Medicine Risk Factors for Colonization with
S.aureus
and
Methicillin
Resistant Staphylococcus aureus
Among Health Care Workers in
Al-Batool teaching hospital for
maternity and children in Diyala,
Iraq Mohamed Mahj... |
https://openalex.org/W4306173537 | https://jnanobiotechnology.biomedcentral.com/counter/pdf/10.1186/s12951-022-01641-0 | English | null | Cancer-derived small extracellular vesicles: emerging biomarkers and therapies for pancreatic ductal adenocarcinoma diagnosis/prognosis and treatment | Journal of nanobiotechnology | 2,022 | cc-by | 19,048 | © The Author(s) 2022. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use,
sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and
the source, provide a link to t... |
https://openalex.org/W4297944867 | https://zenodo.org/records/7124172/files/ZDPP2307.pdf | Quechua | null | MUSTAQIL SÓZ TURKUMLARINING ÓZIGA XOS XUSUSIYATLARI | Zenodo (CERN European Organization for Nuclear Research) | 2,022 | cc-by | 497 | ARI ARI O`qituvchi, Termiz davlat universiteti qoshidagi akadem
https://doi.org/10.5281/zenodo.7124172 O`qituvchi, Termiz davlat universiteti qoshidagi akademik litsey
https://doi.org/10.5281/zenodo.7124172 So‘zlarning lug‘aviy va grammatik ma’no jihatdan o‘xshashligiga ko‘ra ayrim
leksik - grammatik guruhlariga ajra... |
https://openalex.org/W2097430149 | https://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0007616&type=printable | English | null | Quantitative Assessment of Stereotyped and Challenged Locomotion after Lesion of the Striatum: A 3D Kinematic Study in Rats | PloS one | 2,009 | cc-by | 10,557 | Quantitative Assessment of Stereotyped and Challenged
Locomotion after Lesion of the Striatum: A 3D Kinematic
Study in Rats Olivier Perrot, Davy Laroche, Thierry Pozzo, Christine Marie* Olivier Perrot, Davy Laroche, Thierry Pozzo, Christine Marie*
INSERM U887 Motricite´-Plasticite´, Universite´ de Bourgogne, Dijon, Fra... |
https://openalex.org/W2565257577 | https://europepmc.org/articles/pmc5192336?pdf=render | English | null | Role of Uric Acid Metabolism-Related Inflammation in the Pathogenesis of Metabolic Syndrome Components Such as Atherosclerosis and Nonalcoholic Steatohepatitis | Mediators of inflammation | 2,016 | cc-by | 13,338 | Hindawi Publishing Corporation
Mediators of Inflammation
Volume 2016, Article ID 8603164, 15 pages
http://dx.doi.org/10.1155/2016/8603164 Hindawi Publishing Corporation
Mediators of Inflammation
Volume 2016, Article ID 8603164, 15 pages
http://dx.doi.org/10.1155/2016/8603164 Hindawi Publishing Corporation
Mediators of In... |
https://openalex.org/W2214279053 | https://www.nature.com/articles/srep18037.pdf | English | null | CellMethy: Identification of a focal concordantly methylated pattern of CpGs revealed wide differences between normal and cancer tissues | Scientific reports | 2,015 | cc-by | 8,962 | CellMethy: Identification of a focal
concordantly methylated pattern
of CpGs revealed wide differences
between normal and cancer tissues
Fang Wang1,*, Shaojun Zhang1,*, Hongbo Liu1, Yanjun Wei1, Yihan Wang1, Xiaole Han1,
Jianzhong Su1, Dongwei Zhang2, Baodong Xie3 & Yan Zhang1
ved: 23 June 2015
0 November 2015
0 De... |
https://openalex.org/W2016680591 | https://www.scielo.br/j/pusf/a/VcjpqtBmfsK9hMwhK55xjYQ/?lang=pt&format=pdf | Portuguese | null | Fantasias freudianas: aspectos centrais e possível aproximação com o conceito de esquemas de Aaron Beck | Psico-USF | 2,013 | cc-by | 5,983 | Resumen Este artículo discute los puntos sobre el concepto de fantasía, de Sigmund Freud, y se propone a un diálogo entre ellos y
el concepto de esquemas propuesto por la teoría de la terapia cognitiva de Aaron Beck. Esa sugerencia no significa
eclecticismo teórico o práctico y aborda estos conceptos teniendo en cuen... |
https://openalex.org/W1545260418 | https://hal.inria.fr/hal-01590384/document | English | null | Discovery and Integration of Web 2.0 Content into Geospatial Information Infrastructures: A Use Case in Wild Fire Monitoring | Lecture notes in computer science | 2,011 | cc-by | 7,571 | To cite this version: Manuela Núñez-Redó, Laura Díaz, José Gil, David González, Joaquín Huerta. Discovery and Inte-
gration of Web 2.0 Content into Geospatial Information Infrastructures: A Use Case in Wild Fire
Monitoring. 1st Availability, Reliability and Security (CD-ARES), Aug 2011, Vienna, Austria. pp.50-
68, 10.... |
https://openalex.org/W4389146176 | https://www.ijfmr.com/papers/2023/6/9300.pdf | Latin | null | Leisure and Rural Elders: China’s Leisure Education Programmes Under the Rural Revitalization Strategy | International Journal For Multidisciplinary Research | 2,023 | cc-by-sa | 4,798 | Abstract: The World Leisure Organisation’s Charter for Leisure outlines the right to adequate time for rest and for
the pursuit of leisure activity. The right to leisure time and to participate in the cultural life of the
community are significant for the wellbeing of a person. Leisure time refers to the remaining di... |
https://openalex.org/W2136189576 | https://research.vumc.nl/ws/files/878054/283071.pdf | English | null | The dimensional structure of the functional abilities in cases of long-term sickness absence | BMC public health | 2,011 | cc-by | 10,249 | Abstract Background: The health problems that working people suffer can affect their functional abilities and,
consequently, can cause a mismatch between those abilities and the demands of the work, leading to sickness
absence. A lasting decrease in functional abilities can lead to long-term sickness absence and work d... |
https://openalex.org/W2023852236 | https://europepmc.org/articles/pmc2928747?pdf=render | English | null | Are Unfamiliar Neighbours Considered to Be Dear-Enemies? | PloS one | 2,010 | cc-by | 6,617 | Abstract This is an open-access article distributed under the terms of the Creative Commons Attributi
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This study was supported by the Centre National de la Recherche Scientifique (http://www.cn... |
https://openalex.org/W2787701362 | https://kar.kent.ac.uk/65821/15/Milner-Gulland_et_al-2018-Fish_and_Fisheries.pdf | English | null | Translating the terrestrial mitigation hierarchy to marine megafauna by-catch | Fish and fisheries | 2,018 | cc-by | 14,956 | Licence for this version
CC BY (Attribution) Additional information Versions of research works Versions of Record
If this version is the version of record, it is the same as the published version available on the publisher's web site. Cite as the published version. Author Accepted Manuscripts If this document is identi... |
https://openalex.org/W4287728638 | https://zenodo.org/records/6242441/files/Digital%20Identity%20Management-%20A%20key%20factor%20on%20the%20pursuit%20of%20privacy%20and%20the%20fight%20against%20cybercrime.pdf | English | null | Digital Identity Management: a key factor on the pursuit of privacy and the fight against cybercrime (Draft version) | Zenodo (CERN European Organization for Nuclear Research) | 2,020 | cc-by | 8,675 | DIGITAL IDENTITY MANAGEMENT: A KEY FACTOR ON THE
PURSUIT OF PRIVACY AND THE FIGHT AGAINST
CYBERCRIME Mª Cristina Timón López, Julián Valero Torrijos, Ignacio Alamillo Domingo
(More information to complete after the review process) ABSTRACT: The increasing number of actions that take place in the cyberspace, replacin... |
https://openalex.org/W4366333650 | https://comparativemigrationstudies.springeropen.com/counter/pdf/10.1186/s40878-023-00334-3 | English | null | Instead of ‘writing against’ and discarding ‘immigrants’ integration, why not reconceptualize integration as a wicked concept? | Comparative migration studies | 2,023 | cc-by | 9,804 | © The Author(s) 2023. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits
use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original
author(s) and the source, provide a link to t... |
https://openalex.org/W2203942355 | https://threatenedtaxa.org/index.php/JoTT/article/download/1757/3479 | Latin | null | Cave-dwelling bats (Mammalia: Chiroptera) and conservation concerns in South central Mindanao, Philippines | Journal of threatened taxa | 2,015 | cc-by | 7,286 | òͲ󽽮ĦãÝ;DÃý®͗«®ÙÊÖãÙͿÄÊÄÝÙòã®ÊÄ
ÊÄÙÄÝ®Ä^Êçã«ÄãÙ½D®ÄÄÊ͕W«®½®ÖÖ®ÄÝ <ƌŝnjůĞƌ͘dĂŶĂůŐŽϭΘ:ŽŚŶƌŝĞƐ'͘dĂďŽƌĂϮ <ƌŝnjůĞƌ͘dĂŶĂůŐŽϭΘ:ŽŚŶƌŝĞƐ'͘dĂďŽƌĂϮ 1,2 Department of Biological Sciences, College of Arts and Sciences, University of Southern Mindanao, Kabacan,
Cotabato... |
https://openalex.org/W4393221749 | http://catalog.liha-pres.eu/index.php/liha-pres/catalog/download/258/7524/16959-1 | Ukrainian | null | УПРАВЛІННЯ ЕФЕКТИВНІСТЮ ВИРОБНИЦТВА НА АГРАРНОМУ ПІДПРИЄМСТВІ | null | 2,024 | cc-by | 717 | p
g
УПРАВЛІННЯ ЕФЕКТИВНІСТЮ ВИРОБНИЦТВА
НА АГРАРНОМУ ПІДПРИЄМСТВІ
Бардась Артем Володимирович
доктор економічних наук,
професор кафедри менеджменту,
Національний технічний університет «Дніпровська політехніка»
Клименко Аркадій Тимофійович
аспірант кафедри менеджменту,
Національний технічний університет «Дн... |
https://openalex.org/W2887165702 | https://www.matec-conferences.org/10.1051/matecconf/201818304005/pdf | English | null | Sustainable Development in Accordance With the Concept of Industry 4.0 on the Example of the Furniture Industry | MATEC web of conferences | 2,018 | cc-by | 2,874 | © The Authors, published by EDP Sciences. This is an open access article distributed under the terms of the Creative Commons
Attribution License 4.0 (http://creativecommons.org/licenses/by/4.0/). Sustainable Development in Accordance With
the Concept of Industry 4.0 on the Example of
the Furniture Industry Anna Wiśn... |
https://openalex.org/W1981713576 | https://europepmc.org/articles/pmc4348603?pdf=render | English | null | Real-Time Scintigraphic Assessment of Intravenous Radium-223 Administration for Quality Control | BioMed research international | 2,015 | cc-by | 3,415 | Academic Editor: Shekhar Kumta Copyright © 2015 Chadwick L. Wright et al. This is an open access article distributed under the Creative Commons Attribution
License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly
cited. Radium-223 (223Ra) dichloride i... |
https://openalex.org/W3203547160 | https://www.frontiersin.org/articles/10.3389/fcell.2022.844342/pdf | English | null | Extracellular matrix stiffness and TGFβ2 regulate YAP/TAZ activity in human trabecular meshwork cells | bioRxiv (Cold Spring Harbor Laboratory) | 2,021 | cc-by | 16,100 | ORIGINAL RESEARCH
published: 01 March 2022
doi: 10.3389/fcell.2022.844342 Extracellular Matrix Stiffness and
TGFβ2 Regulate YAP/TAZ Activity in
Human Trabecular Meshwork Cells
Haiyan Li 1,2,3, VijayKrishna Raghunathan 4, W. Daniel Stamer 5,6, Preethi S. Ganapathy 1,3,7 and
Samuel Herberg 1,2,3,8,9* 1Department of Ophth... |
https://openalex.org/W2044711830 | https://bmcmedgenet.biomedcentral.com/counter/pdf/10.1186/1471-2350-11-87 | English | null | 1Novel MEFV transcripts in Familial Mediterranean fever patients and controls | BMC medical genetics | 2,010 | cc-by | 3,459 | RESEARCH ARTICLE Open Access © 2010 Medlej-Hashim et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Com-
mons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduc-
tion in any medium, pro... |
https://openalex.org/W2598234126 | https://europepmc.org/articles/pmc5405794?pdf=render | English | null | Cardiovascular involvement and manifestations of systemic Chikungunya virus infection: A systematic review | F1000Research | 2,017 | cc-by | 14,807 | 29 Mar 2017, :390 (doi:
)
First published:
6
10.12688/f1000research.11078.1
02 May 2017, :390 (doi:
)
Latest published:
6
10.12688/f1000research.11078.2
v2 29 Mar 2017, :390 (doi:
)
First published:
6
10.12688/f1000research.11078.1
02 May 2017, :390 (doi:
)
Latest published:
6
10.12688/f1000research.11078.2
v... |
https://openalex.org/W2914294763 | http://ij-aquaticbiology.com/index.php/ijab/article/download/483/459 | English | null | The alwathba wetland reserve lake in Abu Dhabi, United Arab Emirates and its ostracod (seed shrimp) fauna | DOAJ (DOAJ: Directory of Open Access Journals) | 2,018 | cc-by | 6,089 | g
The Al Wathba Wetland Reserve Lake in Abu Dhabi, United Arab Emirates and its
ostracod (seed shrimp) fauna Anitha Saji *1, Steffen Mischke2, Pritpal S. Soorae1, Shakeel Ahmed1, Shaikha Al Dh 1Environment Agency Abu Dhabi (EAD), United Arab Emirates. 2Faculty of Earth Sciences, University of Iceland, Sturlugata 7, As... |
https://openalex.org/W4386837078 | https://ejournal.umm.ac.id/index.php/MEJ/article/download/28313/12881 | English | null | Development of Flip book-Based Interactive Learning Media to Improving Understanding of Statistical Material Concepts | MEJ (Mathematics Education Journal) | 2,023 | cc-by-sa | 1,390 | Abstract Corresponding author:
Abstract
Junior High School
. Keywords:
i
;
f
; s
m
Masrifah, S., Taufik, M.,
Kusumawardana, A., S.. 3
Development of Flip book-
Based Interactive Learning Media to Improving Understanding of Statistical Material
Concepts. 7 2
239 247 DOI : 10.22219/mej.v7i1.28313 Abstract
... |
https://openalex.org/W2800177368 | http://old.scielo.br/pdf/rod/v58n2/2175-7860-rod-58-02-0283.pdf | Portuguese | null | Revisão taxonômica de Machaerium sect. Oblonga (Benth.) Taub. (Leguminosae, Papilionoideae, Dalbergieae) | Rodriguésia | 2,007 | cc-by | 17,210 | Artigo recebido em 07/2006. Aceito para publicação em 03/2007.
1Parte da tese de doutorado do primeiro autor realizada junto ao Programa de Pós-graduação em Biologia Vegetal, Unicamp.
2Universidade Federal dos Vales do Jequitinhonha e Mucuri. Rua da Glória, 187, Centro, 39100-000, Diamantina, MG,
Brasil. cvictor@jknet.... |
https://openalex.org/W2566759407 | https://pure.mpg.de/pubman/item/item_2378397_5/component/file_2378401/2378397.pdf | English | null | Two pathways regulate cortical granule translocation to prevent polyspermy in mouse oocytes | Nature communications | 2,016 | cc-by | 16,712 | ARTICLE Received 12 Jun 2016 | Accepted 27 Oct 2016 | Published 19 Dec 2016 Received 12 Jun 2016 | Accepted 27 Oct 2016 | Published 19 Dec 2016 1 Medical Research Council Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH, UK. 2 Max Planck
Institute for Biophysical Che... |
https://openalex.org/W1982701618 | https://www.scielo.br/j/jvb/a/bLnWWbFdyWGm4JRcX7vt7LJ/?lang=pt&format=pdf | Portuguese | null | Mobilização precoce na fase aguda da trombose venosa profunda de membros inferiores | Jornal Vascular Brasileiro | 2,009 | cc-by | 6,637 | 1 . Acadêmica de Fisioterapia, Universidade do Estado de Santa Catarina (UDESC), Florianópolis, SC.
2 . Mestranda, UDESC, Florianópolis, SC.
3 . Doutor. Médico especialista, Cardiologia e Medicina do Esporte. Coordenador, professor, Núcleo de Cardiologia e Medicina do Exercício, Centro de Ciências da
Saúde e do Esporte... |
https://openalex.org/W1976479029 | https://redc.revistas.csic.es/index.php/redc/article/download/674/749/1163, https://digital.csic.es/bitstream/10261/77746/1/2010-33-4%20Analisis%20de%20genero.pdf | es | Análisis de género, productividad científica y colaboración de las profesoras universitarias de Ciencias de la Salud en la Comunidad Valenciana (2003-2007) | Revista española de documentación científica | 2,010 | cc-by | 7,461 | Revista Española de Documentación Científica,
33, 4, octubre-diciembre, 624-642, 2010
ISSN: 0210-0614. doi: 10.3989/redc.2010.4.764
Análisis de género, productividad científica
y colaboración de las profesoras universitarias
de Ciencias de la Salud en la Comunidad
Valenciana (2003-2007)
Adolfo Alonso-Arroyo*, Máxima B... | |
https://openalex.org/W4311574565 | https://bmcwomenshealth.biomedcentral.com/counter/pdf/10.1186/s12905-022-02089-y | English | null | Value of endometrial thickness for the detection of endometrial cancer and atypical hyperplasia in asymptomatic postmenopausal women | BMC women's health | 2,022 | cc-by | 5,486 | Abstract Conclusion: An ET cut-off of ≥ 8 mm shows a reasonable performance to detect AH and EC in asymptomatic post-
menopausal women, thereby avoiding more invasive endometrial biopsy. Keywords: Asymptomatic, Endometrial carcinoma, Postmenopausal, Ultrasonography © The Author(s) 2022. Open Access This article is li... |
https://openalex.org/W4376224274 | https://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0285662&type=printable | English | null | Experiences, barriers, and facilitators of health data use among performance monitoring teams (PMT) of health facilities in Eastern Ethiopia: A qualitative study | PloS one | 2,023 | cc-by | 8,889 | PLOS ONE PLOS ONE RESEARCH ARTICLE Experiences, barriers, and facilitators of
health data use among performance
monitoring teams (PMT) of health facilities in
Eastern Ethiopia: A qualitative study Admas AberaID1*, Abebe ToleraID1, Biruk Shalmeno Tusa1, Adisu Birhanu Weldesenbet1,
Assefa Tola1, Tilahun ShiferawID2, Alem... |
https://openalex.org/W3177322031 | https://www.um.edu.mt/library/oar/bitstream/123456789/78054/1/The_impact_of_COVID-19_on_hospitalised_COPD_exacerbations_in_Malta_2021.pdf | English | null | The Impact of COVID-19 on Hospitalised COPD Exacerbations in Malta | Pulmonary medicine | 2,021 | cc-by | 5,797 | Correspondence should be addressed to Yvette Farrugia; yvette.a.farrugia@gov.mt Correspondence should be addressed to Yvette Farrugia; yvette.a.farrugia@gov.mt Received 7 February 2021; Revised 3 June 2021; Accepted 12 June 2021; Published 29 June 2021 Academic Editor: Zsofia Lazar Copyright © 2021 Yvette Farrugia et al... |
https://openalex.org/W4366002489 | https://riviste.unimi.it/index.php/glocalism/article/download/21303/18915 | English | null | Address to “Glocalism” by the Mayor of Milan | Glocalism | 2,014 | cc-by-sa | 486 | ADDRESS TO “GLOCALISM”
BY THE MAYOR OF MILAN GIULIANO PISAPIA
Mayor of Milan It is now little less than a year until the appointment
with Expo 2015. It will be the global event that will put
Milan at the centre of the international debate on the
theme of the second Milanese Universal Exposition after
the one held... |
https://openalex.org/W4200186211 | https://bajangjournal.com/index.php/IJSS/article/download/702/508 | English | null | INTERACTIVE POWERPOINTS IN ONLINE TGT-BASED MODELS ON THERMOCHEMICAL MATERIALS | International Journal of Social Science | 2,021 | cc-by | 5,761 | ABSTRACT The closure of schools due to the Covid-19 pandemic has forced all schools in
Indonesia to be closed temporarily, therefore learning must be carried out online. Online learning is commonly carried out with teacher presentations and assignments
therefore this makes learning monotonous and boring for students.... |
W2317090586.txt | https://zenodo.org/records/1693031/files/article.pdf | de | Das Gräberfeld am Windmühlenberge bei Klein- Quenstedt, Kr. Halberstadt | Praehistorische Zeitschrift | 1,911 | public-domain | 3,400 | 274
Das Gräberfeld am Windmühlenberge bei KleinQuenstedt, Kr. Halberstadt
Von Hugo Mötefindt
E i n e d u r c h ihren S i e d l u n g s r e i c h t u m für die V o r g e s c h i c h t s f o r s c h u n g
b e s o n d e r s w i c h t i g e G e g e n d ist die U m g e b u n g H a i b e r s t a d t s .
H i e r ist der
B e ... | |
https://openalex.org/W4239333681 | https://mhealth.jmir.org/2019/12/e13671/PDF | English | null | Use of mHealth Apps and Wearable Technology to Assess Changes and Predict Pain During Treatment of Acute Pain in Sickle Cell Disease (Preprint) | null | 2,019 | cc-by | 11,546 | Corresponding Author: Corresponding Author:
Amanda Johnson, MD, BA
Department of Pediatrics
Duke University
2301 Erwin Road
Durham, NC, 27710
United States
Phone: 1 651 207 3255
Email: amanda@ohsu.edu JMIR Mhealth Uhealth 2019 | vol. 7 | iss. 12 | e13671 | p. 1
(page number not for citation purposes) https://mhealth.jm... |
https://openalex.org/W4391534304 | https://www.scielo.br/j/acr/a/DYdXkqJGYzhTMT7Y5FvYkcq/?lang=en&format=pdf | English | null | Protective measures against COVID-19: communicative, social and emotional impacts on hearing aids users | Audiology - Communication Research | 2,024 | cc-by | 7,900 | RESUMO Purpose: to investigate the communicative, social, and emotional
impacts generated by adopting protective measures against COVID-19
and associate them with the degree of hearing loss and the time of use
of hearing aids. Methods: cross-sectional quantitative study, with 72
individuals, divided into adults and... |
https://openalex.org/W3212682533 | https://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0259842&type=printable | English | null | Use of universal primers for the 18S ribosomal RNA gene and whole soil DNAs to reveal the taxonomic structures of soil nematodes by high-throughput amplicon sequencing | PloS one | 2,021 | cc-by | 20,000 | PLOS ONE PLOS ONE Use of universal primers for the 18S
ribosomal RNA gene and whole soil DNAs to
reveal the taxonomic structures of soil
nematodes by high-throughput amplicon
sequencing Harutaro Kenmotsu1☯, Emi Takabayashi1☯, Akinori Takase1☯, Yuu Hirose1,2,
Toshihiko EkiID1,2* a1111111111
a1111111111
a1111111111
a1111... |
https://openalex.org/W2198484515 | https://www.edscience.ru/jour/article/download/107/102 | Russian | null | Interpreting the Social Order for the Moral Personality Upbringing in the Context of the New Educational Standards. | Obrazovanie i nauka | 2,015 | cc-by | 1,950 | 1 Статья печатается при поддержке гранта РГНФ № 11–06–00230а «Проек-
тирование духовно-нравственной среды образовательных учреждений с использо-
ванием социо-культурного пространства региона». Образование и наука. 2012. № 9 (98) Интерпретация социального заказа на воспитание духовно-нравственной личности в
государстве... |
https://openalex.org/W2964680331 | https://europepmc.org/articles/pmc6827534?pdf=render | English | null | Influence of Manually Adjustable Photovoltaic Array on the Performance of Water Pumping Systems | Global challenges | 2,019 | cc-by | 6,210 | Influence of Manually Adjustable Photovoltaic Array on the
Performance of Water Pumping Systems Vinamrita Singh water pump poses a limitation. Diesel
based water pumps require fuel to be
transported to the location, are noisy and
polluting, and have significant mainte-
nance requirements.[8] Altogether, these
pump... |
https://openalex.org/W2977123687 | https://cfmetrologie.edpsciences.org/articles/metrology/pdf/2019/01/metrology_cim2019_20003.pdf | English | null | Influence of storage time of pulp and paper industry wastewaters in AOX determination | null | 2,019 | cc-by | 3,600 | Influence of storage time of pulp and paper
industry wastewaters in AOX determination Micaela A. R. Soares1,*, Manuela Marques1, and Maria Teresa Rodrigues1 AIZ – Instituto de Investigação da Floresta e Papel, Rua José Estevão, 3800-783 Aveiro, Portugal Abstract. The feasibility of storing wastewater samples from pulp... |
https://openalex.org/W2589244411 | https://europepmc.org/articles/pmc5324225?pdf=render | English | null | Performance of Firth-and logF-type penalized methods in risk prediction for small or sparse binary data | BMC Medical research methodology | 2,017 | cc-by | 10,061 | Rahman and Sultana BMC Medical Research Methodology (2017) 17:33
DOI 10.1186/s12874-017-0313-9 Rahman and Sultana BMC Medical Research Methodology (2017) 17:33
DOI 10.1186/s12874-017-0313-9 © The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
Internat... |
https://openalex.org/W2600584577 | https://hal.science/hal-01605881/document | English | null | Quantitative Methods to Assess Differential Susceptibility of Arabidopsis thaliana Natural Accessions to Dickeya dadantii | Frontiers in plant science | 2,017 | cc-by | 8,279 | Quantitative methods to assess differential susceptibility
of arabidopsis thaliana natural accessions to dickeya
dadantii Martine Rigault, Amélie Buellet, Céline Masclaux-Daubresse, Mathilde
Fagard, Fabien Chardon, Alia Dellagi To cite this version: Martine Rigault, Amélie Buellet, Céline Masclaux-Daubresse, Mathilde F... |
https://openalex.org/W2916422292 | https://europepmc.org/articles/pmc6382824?pdf=render | English | null | CXCR4 signaling regulates metastatic onset by controlling neutrophil motility and response to malignant cells | Scientific reports | 2,019 | cc-by | 14,128 | CXCR4 signaling regulates
metastatic onset by controlling
neutrophil motility and response to
malignant cells Received: 9 May 2018
Accepted: 18 December 2018
Published: xx xx xxxx C. Tulotta, C. Stefanescu, Q. Chen, V. Torraca , A. H. Meijer & B. E. Snaar-Jagalska Developing tumors interact with the surrounding mi... |
https://openalex.org/W2969883408 | https://europepmc.org/articles/pmc6747555?pdf=render | English | null | Dual Beam In Situ Radiation Studies of Nanocrystalline Cu | Materials | 2,019 | cc-by | 9,601 | Received: 25 July 2019; Accepted: 21 August 2019; Published: 25 August 2019 Abstract: Nanocrystalline metals have shown enhanced radiation tolerance as grain boundaries serve
as effective defect sinks for removing radiation-induced defects. However, the thermal and radiation
stability of nanograins are of concerns since... |
https://openalex.org/W2180448528 | https://www.matec-conferences.org/articles/matecconf/pdf/2015/12/matecconf_icmee2015_13001.pdf | English | null | The research of creep in tunnel which surrounding rock is expansion | MATEC web of conferences | 2,015 | cc-by | 3,069 | 1 Introduction tunnel.So researches on creep properties of expansive
rock tunnel have great significance for design and
construction.For this reason, based on the expansive rock
tunnel in YiHe highway large cross section in GuangXi
province, this essay simulates the expansive rock tunnel’s
creep characteristics in... |
https://openalex.org/W3110213707 | https://www.e3s-conferences.org/10.1051/e3sconf/202021303014/pdf | English | null | Stress Concentration Factors for Multi-planar Tubular Joints Subjected to Axial Loading | E3S web of conferences | 2,020 | cc-by | 3,672 | 1 Introduction The substructure of
offshore wind turbine Fig. 1. The substructure of
offshore wind turbine Fig. 2. Schematic diagram of
tubular joints. Stress Concentration Factors for Multi-planar Tubular Joints
Subjected to Axial Loading Kai Zhou1, Jingjing Zuo1, Wenhua Wang2,*, Shiliu Bao2
1Powerchina Zhongnan ... |
https://openalex.org/W4390442419 | https://link.springer.com/content/pdf/10.1007/s12035-023-03858-y.pdf | English | null | Presenilin2 D439A Mutation Induces Dysfunction of Mitochondrial Fusion/Fission Dynamics and Abnormal Regulation of GTPase Activity | Molecular neurobiology | 2,023 | cc-by | 16,915 | Abstract Alzheimer’s disease (AD) is an age-related progressive neurodegenerative disease, and approximately 10% of AD cases
are early-onset familial AD (EOFAD), which is mainly linked to point mutations in genes encoding presenilins (PS1 and
PS2). Mutations in PS2 are extremely rare and have not received enough atte... |
https://openalex.org/W3172642099 | https://ejim.springeropen.com/counter/pdf/10.4103/ejim.ejim_4_19 | English | null | Association of new obesity indices; visceral adiposity index and body adiposity index, with metabolic syndrome parameters in obese patients with or without type 2 diabetes mellitus | The Egyptian Journal of Internal Medicine/The Egyptian Journal of Internal Medicine | 2,019 | cc-by | 6,213 | 620
Original article 620
Original article © 2020 The Egyptian Journal of Internal Medicine | Published by Wolters Kluwer - Medknow Background Obesity is the cornerstone of metabolic syndrome (MetS); it is not possible to use
BMI to differentiate between lean mass and fat mass. We aimed to investigate, for
the first tim... |
https://openalex.org/W4231097000 | https://figshare.com/articles/thesis/Financial_Socialization_for_Digital_Natives_A_New_Way_to_Teach_Children_About_Money/14651556/1/files/28133280.pdf | English | null | Financial Socialization for Digital Natives: A New Way to Teach Children About Money | null | 2,021 | cc-by | 11,601 | by Anika Chowdhury AUTHOR’S DECLARATION I hereby declare that I am the sole author of this MRP. This is a true copy of the MRP, including
any required final revisions. I authorize Ryerson University to lend this MRP to other institutions
or individuals for the purpose of scholarly research. I further authorize Ryerso... |
https://openalex.org/W2944508336 | https://www.biorxiv.org/content/biorxiv/early/2019/03/08/352344.full.pdf | English | null | A highly predictive signature of cognition and brain atrophy for progression to Alzheimer's dementia | Gigascience | 2,019 | cc-by | 15,820 | .
CC-BY 4.0 International license
available under a
not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made
The copyright holder for this preprint (which was
this version posted March 8, 2019.
;
https://doi.org/10.1101/352344
doi:
bioRx... |
https://openalex.org/W4214636866 | https://www.epj-conferences.org/articles/epjconf/pdf/2022/04/epjconf_nic16th2022_01002.pdf | English | null | The <sup>12</sup>C+<sup>12</sup>C fusion reaction at stellar energies | EPJ web of conferences | 2,022 | cc-by | 5,383 | ∗e-mail: xtang@impcas.ac.cn
∗∗e-mail: rulonghui@impcas.ac.cn Xiaodong Tang1,2,3,∗and Longhui Ru1,2,∗∗ Xiaodong Tang1,2,3,∗and Longhui Ru1,2,∗∗ 1Institute of modern physics, Chinese Academy of Sciences, Lanzhou, 730000, China 1Institute of modern physics, Chinese Academy of Sciences, Lanzhou, 730000, China
2School of Nu... |
https://openalex.org/W2750585180 | https://wnus.edu.pl/cto/file/article/view/6412.pdf | Polish | null | Księga Mądrości na dziś (Maneat Questio 26), Poznań 2014, ss. 141 | Colloquia Theologica Ottoniana/Colloquia Theologica Ottoniania | 2,016 | cc-by-sa | 784 | 1 Ks. dr Tomasz Zaklukiewicz – specjalizuje się w teologii biblijnej. E-mail: zakluk@szcze-
cin.opoka.org.pl. COLLOQUIA THEOLOGICA OTTONIANA 2/2016, s. 239–241 COLLOQUIA THEOLOGICA OTTONIANA 2/2016, s. 239–241 DOI: 10.18276/cto.2016.2-14 DOI: 10.18276/cto.2016.2-14 BOGDAN PONIŻY, KSIĘGA MĄDROŚCI NA DZIŚ
(MANEAT QUEST... |
https://openalex.org/W4388826577 | https://geusbulletin.org/index.php/geusb/article/download/8353/14403 | English | null | Machine learning-based estimation and clustering of statistics within stratigraphic models as exemplified in Denmark | GEUS bulletin | 2,023 | cc-by | 5,447 | METHOD ARTICLE | SHORT METHOD ARTICLE | SHORT METHOD ARTICLE | SHORT Frederik Alexander Falk*1
, Rasmus Bødker Madsen2 Frederik Alexander Falk*1
, Rasmus Bødker Madsen2 1Department of Geoscience, Aarhus University, Aarhus, Denmark; 2Department of Near Surface Land and Marine Geology, Geological Survey of
Denmark and... |
https://openalex.org/W2092121466 | https://hal.archives-ouvertes.fr/hal-01608554/document | French | null | Rapid and quantitative assessment of trout spermatozoa motility using stroboscopy | Aquaculture | 1,985 | cc-by-sa | 130 | To cite this version: Marie-Paule Cosson, Roland Billard, J.L. Gatti, R. Christen. Rapid and quantitative assessment of
trout spermatozoa motility using stroboscopy. Aquaculture, 1985, 46 (1), pp.71-75. 10.1016/0044-
8486(85)90178-4. hal-01608554 HAL Id: hal-01608554
https://hal.science/hal-01608554v1
Submitted on ... |
https://openalex.org/W4320495066 | https://hal.science/hal-03986050/document | English | null | Challenges and perspectives in MS-based omics approaches for ecotoxicology studies: An insight on Gammarids sentinel amphipods | Frontiers in analytical science | 2,023 | cc-by | 7,651 | Challenges and perspectives in MS-based omics
approaches for ecotoxicology studies: An insight on
Gammarids sentinel amphipods Valentina Calabrese, Arnaud Salvador, Yohann Clément, Thomas Alexandre
Brunet, Anabelle Espeyte, Arnaud Chaumot, Olivier Geffard, Davide
Degli-Esposti, Sophie Ayciriex To cite this version: Val... |
https://openalex.org/W3145567274 | https://hal.archives-ouvertes.fr/hal-03244564/document | English | null | COVID-19–Related National Re-confinement: Recommendations From the National French Observatory for Physical Activity and Sedentary Behaviors (ONAPS) | Journal of physical activity & health | 2,021 | cc-by | 3,582 | To cite this version: David Thivel, Michele Tardieu, Pauline Genin, Alicia Fillon, Benjamin Larras, et al.. COVID-19-
Related National Re-confinement: Recommendations From the National French Observatory for Phys-
ical Activity and Sedentary Behaviors (ONAPS). Journal of Physical Activity and Health (JPAH),
2021, 18 (5... |
https://openalex.org/W2790327029 | https://wnus.usz.edu.pl/frfu/file/article/view/11392.pdf | Polish | null | Motives for Trade Credit Use by Micro-enterprises | Finanse, Rynki Finansowe, Ubezpieczenia | 2,016 | cc-by-sa | 3,982 | Finanse, Rynki Finansowe, Ubezpieczenia nr 4/2016 (82/1) Finanse, Rynki Finansowe, Ubezpieczenia nr 4/2016 (82/1) Finanse, Rynki Finansowe, Ubezpieczenia nr 4/2016 (82/1) DOI: 10.18276/frfu.2016.4.82/1-46 s. 559–567 * dr Katarzyna Ziętek-Kwaśniewska, Katolicki Uniwersytet Lubelski Jana Pawła II, Instytut Ekonomii i Zar... |
https://openalex.org/W4362464156 | https://zenodo.org/records/7793422/files/43147.pdf | Polish | null | Effective motor learning and coordination abilities of girls and boys aged 9-10 | Journal of Education, Health and Sport | 2,023 | cc-by | 9,315 | Introduction Learning is a complex and multi-dimensional process that depends on cognitive and emotional processes and the
development of functional systems of the human body. One type of learning is motor learning. Its course and effects
depend on many factors. One of the factors may be coordination abilities. p
The c... |
https://openalex.org/W2188405496 | https://jds-online.org/journal/JDS/article/590/file/pdf | English | null | Inference for Semiparametric AUC Regression Models with Discrete Covariates | Journal of data science | 2,021 | cc-by | 5,216 | Journal of Data Science 9(2011), 625-637 Journal of Data Science 9(2011), 625-637 Lin Zhang1, Yan D. Zhao2∗and Jack D. Tubbs3
1Quintiles Inc., 2University of Texas Southwestern Medical Center and
3Baylor University Abstract: In this paper we consider clinical trials with two treatments and
a non-normally distributed re... |
https://openalex.org/W2530873173 | http://journals.iucr.org/e/issues/2016/11/00/pk2592/pk2592.pdf | English | null | Synthesis and crystal structure of La<sub>21</sub>Cr<sub>8−2<i>a</i></sub>Al<sub><i>b</i></sub>Ge<sub>7−<i>b</i></sub>C<sub>12</sub>[<i>a</i>= 0.22 (2) and<i>b</i>= 0.758 (19)] | Acta crystallographica. Section E, Crystallographic communications | 2,016 | cc-by | 5,297 | research communications research communications Jaskarun Pabla, Yuri Janssen and Jack W. Simonson* Department of Physics, Farmingdale State College, Farmingdale, NY 11735, USA. *Correspondence e-mail:
jack.simonson@farmingdale.edu Received 9 September 2016
Accepted 4 October 2016 Received 9 September 2016
Accepted 4 Oc... |
https://openalex.org/W4389616337 | https://isegoria.revistas.csic.es/index.php/isegoria/article/download/1341/1699 | es | Con manos de ángel: figuras del cuidado en la obra de Miguel de Unamuno | Isegoría | 2,023 | cc-by | 8,689 | ISEGORÍA. Revista de Filosofía moral y política
N.º 69, julio-diciembre, 2023, e19
ISSN-L: 1130-2097 | eISSN: 1988-8376
https://doi.org/10.3989/isegoria.2023.69.19
ARTÍCULOS
Con manos de ángel: figuras del cuidado en la obra de
Miguel de Unamuno
With Angel’s Hands: Figures of Care in Miguel de Unamuno’s Plays
Olaya Fe... | |
https://openalex.org/W4294091459 | https://figshare.com/articles/preprint/Payload-Byte_A_Tool_for_Extracting_and_Labeling_Packet_Capture_Files_of_Modern_Network_Intrusion_Detection_Datasets/20714221/2/files/38302704.pdf | English | null | Payload-Byte: A Tool for Extracting and Labeling Packet Capture Files of Modern Network Intrusion Detection Datasets | null | 2,022 | cc-by | 9,120 | This paper was downloaded from TechRxiv (https://www.techrxiv.org). LICENSE CC BY 4.0 SUBMISSION DATE / POSTED DATE
29-08-2022 / 30-11-2022 Payload-Byte: A Tool for Extracting and Labeling
Packet Capture Files of Modern Network Intrusion
Detection Datasets Yasir Ali Farrukh
Clean and Resilient Energy System Lab
Texas A... |
https://openalex.org/W2611123435 | https://ojs.cvut.cz/ojs/index.php/ap/article/download/1015/847 | English | null | Automatic Compensation of Workpiece Positioning Tolerances for Precise Laser | Acta Polytechnica | 2,008 | cc-by | 5,010 | Acta Polytechnica Vol. 48 No. 3/2008 Acta Polytechnica Vol. 48 No. 3/2008 Automatic Compensation of Workpiece
Positioning Tolerances for Precise Laser
Welding N. C. Stache, T. P. Nguyen Precise laser welding plays a fundamental role in the production of high-tech goods, particularly in precision engineering. In this ... |
https://openalex.org/W3164818910 | https://ejnpn.springeropen.com/counter/pdf/10.1186/s41983-021-00302-7 | English | null | Impact of gender, depression severity and type of depressive episode on efficacy and safety of escitalopram: an observational study on major depressive disorder patients in southern India | The Egyptian Journal of Neurology, Psychiatry and Neurosurgery /The Egyptian Journal of Neurology, Psychiatry and Neurosurgery | 2,021 | cc-by | 8,224 | RESEARCH Open Access The Egyptian Journal of Neurology,
Psychiatry and Neurosurgery The Egyptian Journal of Neurology,
Psychiatry and Neurosurgery Mandal et al. The Egyptian Journal of Neurology, Psychiatry and Neurosurgery
(2021) 57:47 https://doi.org/10.1186/s41983-021-00302-7 ttps://doi.o... |
https://openalex.org/W4238158638 | https://repository.library.noaa.gov/view/noaa/24495/noaa_24495_DS1.pdf | English | null | Simulating secondary organic aerosol in a regional air quality model using the statistical oxidation model – Part 2: Assessing the influence of vapor wall losses | null | 2,015 | cc-by | 18,233 | Correspondence to: Christopher D. Cappa (cdcappa@ucdavis.edu) Correspondence to: Christopher D. Cappa (cdcappa@ucdavis.edu) Received: 21 October 2015 – Published in Atmos. Chem. Phys. Discuss.: 3 November 2015
Revised: 29 January 2016 – Accepted: 19 February 2016 – Published: 9 March 2016 Abstract. The influence of loss... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.